Википедия белокрылка: Белокрылки | справочник Пестициды.ru

Содержание

Белокрылки | справочник Пестициды.ru

Семейство включает в себя более 1500 видов, объединенных в 160 родов и 3 подсемейства. Латинское название Aleurodidae происходит от греческого aleuron, что означает «мука». Связано это с белым пылевидным налетом на крыльях насекомых, напоминающим муку мелкого помола. Русское название также связано с двумя парами белых крыльев и говорит само за себя[5]. Малоизученная группа равнокрылых насекомых, ближе всего стоящая к листоблошкам[1].

 

Морфологическое строение тепличной (оранжерейной) белокрылки (лат. Trialeurodes vaporariorum)


Морфологическое строение тепличной (оранжерейной) белокрылки (лат.

Trialeurodes vaporariorum)



1 – голова, 2 – переднеспинка, 3 – крылья, 4 – усики,


5 – глаз, 6 – ноги


Использовано изображение:[7]

Морфология

Имаго

Длина тела не превышает 2 мм, ширина 0.3-0.7 мм. Похожи на микроскопических молей или бабочек. Обычно не прыгают.

. Тело имеет желтый окрас, иногда с темным рисунком. Покрыто пыльцевидным налетом[5].
. Усики длинные, чаще 7-члениковые (от 3 до 7). Глаза сложные, хорошо развиты, разделены поперечной перетяжкой на спинную и брюшную части[5].
. Две пары. Непрозрачные. Покрыты мелкой белой пыльцой, напоминающей муку. В спокойном состоянии складываются над брюшком в виде плоской крышечки. Белого цвета, иногда с темными, почти черными, пятнами различного числа и размера[5].
. Удлиненные, с тонкими бедрами. Лапки 2-члениковые[5].

Половой диморфизм

Отличаются строением половых органов[2].

Яйцо

Размеры 0,2-0,3 мм в длину. Имеют стебелек, при помощи которого прикрепляются к субстрату. Крепление открытое. Цвет от бело-желтого или зеленоватого до насыщенно желтого, темнеющего со временем. Часто покрыты порошковидным налетом[2].

Личинка

Очень мелкие, менее 1 мм в длину, практически неразличимые невооруженным глазом. Овоидной формы, плоские. Покровы несут короткие волоски и нити на конце тела. Цвет личинок младших возрастов прозрачно-белый, с желтоватым или зеленоватым оттенком. Проходят 4 возраста, но только личинки Iвозраста подвижны, благодаря чему их иногда называют «бродяжками», имеют 3 пары ног и усики.[1]Личинки последующих возрастов неподвижны, ноги и усики атрофируются до рудиментарного состояния. Личинки IV возраста приобретают выпуклость форм, становятся непрозрачными и покрываются с боков восковым слоем – пупарием. Размеры варьируют от 0,8 мм до 1,3 мм в длину и от 0,3 до 0,6 мм в ширину. Покровы из воска (пупарий) часто сверху имеют разнообразные выросты в виде пластин, завитков или плотного сплошного слоя. Цвет пупария вариативен, от светло-желтого или зеленоватого до коричневого. Различия в строении и окрасе пупария имеют важное диагностическое значение в видовом определении алейродид. Как правило, личинку последнего возраста называют куколкой или ложнокуколкой, хотя, формально, она таковой не является[2].

Яйца тепличной белокрылки (Trialeurodes vaporariorum)


Яйца тепличной белокрылки (

Trialeurodes vaporariorum)



Использовано изображение:[8]

Развитие

Развитие неполное усложненное, по типу гиперморфоза[1]. От полного метаморфоза (гиперметаморфоза) гиперморфоз отличается тем, что во время прохождения личиночной стадии развития, появляется покоящаяся, малоподвижная фаза, называемая так же ложнокуколкой. По своему строению она напоминает имаго[2]. В зависимости от температуры, за вегетационный период наблюдается развитие от 1 до нескольких поколений, в среднем 3. При благоприятных условиях могут развиваться круглогодично, в этом случае число поколений в год сильно возрастает (10-15 и более)[3].

. Откладка яиц начинается весной с наступлением устойчивой теплой погоды (в средней полосе России, как правило, в начале мая)[6]. В теплом климате, либо в условиях теплиц и оранжерей размножение может происходить круглогодично. Яйца на растении (обычно нижняя сторона листьев) располагаются хаотично или небольшими группами в виде колец, большие скопления образуют редко[3]. (фото)
. Вышедшие из яиц личинки I возраста активно передвигаются в поисках пищи, затем, найдя подходящее место, присасываются к растению и теряют подвижность вплоть до превращения в имаго. Перестают питаться на стадии личинки IV возраста (ложнокуколки или пупария), когда начинается формирование структур и органов взрослого насекомого. Стадия развития пупария продолжается, в среднем, 10-14 дней[3].
. Развитие от яйца до имаго занимает 20-40 дней в зависимости от температуры и влажности. Начинают копулировать через 2-3 дня после вылупления, после чего начинается откладка яиц. Плодовитость так же зависит от условий окружающей среды. При 20-27°С и влажности порядка 70-90% количество отложенных яиц достигает 300 штук. Продолжительность жизни самки составляет около 30 суток[2].
. Обитают, как правило, во влажных тенистых местах, особенно часто встречаются на нижней стороне листьев растений. Личинки всех возрастов питаются клеточным соком растений, выделяя при этом сахароподобные вещества – падь. На зиму уходят пупарии или имаго, оставаясь в грунте (под листьями, травой, комками земли) до наступления весны. Личинки погибают[2].

Географическое распространение

Белокрылки – теплолюбивые насекомые, тяготеющие к жаркому влажному климату. В естественных условиях наибольшей численности и видового разнообразия достигают в тропиках и субтропической зоне. Однако в искусственно поддерживаемых условиях парников, теплиц и оранжерей встречаются повсеместно. На территории России регистрируются 20-30 видов белокрылок, преимущественно в южных районах страны[1].

Гибискус, пораженный белокрылкой


Гибискус, пораженный белокрылкой



Использовано изображение:[9]

Меры борьбы

Белокрылки являются опасными вредителями многих видов растений с высоким потенциалом размножения. Достигая высокой численности, представляют значительную угрозу для плодовых, овощных, цветочных культур и других хозяйственно ценных растений. По возможности, зараженные белокрылкой растения, следует поместить в карантинные условия, либо постараться максимально изолировать растение от других. Избавиться от белокрылки – очень трудная задача, и часто самый простой и эффективный способ предотвратить распространение вредителя – выкинуть или уничтожить пораженное растение[3]. (фото)

Профилактические меры

  • уничтожение сорняков, ботвы, опавших листьев и остатков урожая;
  • в закрытых помещениях (теплицах, оранжереях) соблюдать гидротермический режим, не допускать заноса насекомых внутрь с новыми растениями или сорняками.
  • периодический осмотр растений на предмет наличия вредителей[3].

Пестициды

Опрыскивание в процессе вегетации:

В личных подсобных хозяйствах:

Внесение брикетов под растения с неодревесневшими стеблями на расстоянии 2-3 см от стебля в предварительно политую почву:

Полив почвы под растениями:

Истребительные меры

:

  • Клеевые ловушки, ленты желтого или белого цвета

Обработка фосфорорганическими соединениями, неоникотиноидами, синтетическими пиретроидами, ингибиторами синтеза хитина, минеральными маслами, ювеноидами и другими инсектицидами[4].

:

Применение биологических пестицидов; подселение паразитических организмов или хищных видов насекомых, снижающих численность белокрылки. Например, паразитическое насекомое энкарзия, хищный клоп макролофус, хищный клещ Амблисейус, энтомопатогенные грибы ашерсония, боверия и др[3].

Белокрылки — это… Что такое Белокрылки?

Белокрылки
Bemisia argentifolii
Научная классификация

промежуточные ранги

Надсемейство:  Aleyrodoidea
Семейство:  Белокрылки
Международное научное название

Aleyrodidae Westwood, 1840

Подсемейства
  • Aleurodicinae
  • Aleyrodinae
  • Udamoselinae

Белокрылки (лат. Aleyrodidae) — семейство мелких полужёсткокрылых насекомых из подотряда Sternorrhyncha, выделяемое в монотипное надсемейство Aleyrodoidea. Насчитывают около 1550 видов. В Средней Европе около 20 видов.

Описание

Европейские виды семейства обычно около 1,3—1,8 мм в длину (до 3 мм). Немного напоминают мелких молевидных чешуекрылых. Тело белое или желтовато-красное, с тёмными пятнами. Имеют 4 крыла, которые покрыты белым пылевидным налётом, напоминающим муку, в покое складываются кровлеобразно. Личинки первого возраста подвижны, последующих — неподвижны. Питаются соками растений. Обычно держатся на нижней поверхности листьев. Некоторые виды являются опасными карантинными вредителями растений.

Систематика

Выделяют более 1500 видов, 160 родов и 3 подсемейства.

Известные виды

  • Тепличная, или оранжерейная, белокрылка (Trialeurodes vaporariorum) — в теплицах и оранжереях. Повреждает томаты, огурцы и некоторые цветочные растения.
  • Цитрусовая белокрылка (Dialeurodes citri) встречается в Японии, Индии, Китае, Северной и Южной Америке; в России — на Черноморском побережье Кавказа. Опасный карантинный вредитель цитрусовых культур.
  • Земляничная белокрылка (Aleurodes fragariae) встречается в Европе. Вредитель земляники.
  • Капустная белокрылка (Aleurodes brassicae)
  • Табачная белокрылка (Bemisia tabaci)

Литература

  • David, B. V., Dubey A. K. (2008). Aleyrodid (Hemiptera: Aleyrodidae) fauna of Sri Lanka with description of a new species. Oriental Insects 42: 349—357.
  • Dumbleton, L. J. (1957). The New Zealand Aleyrodidae (Hemiptera: Homoptera). Pacific science 11: 141—160. [1]
  • Martin, J. H., Mound, L. A. (2007). An annotated check list of the world’s whiteflies (Insecta: Hemiptera: Aleyrodidae). Zootaxa 1492: 1-84. Текст  (англ.)  (Проверено 11 сентября 2010)

Ссылки

7 естественных инсектицидов для мелких фермеров, которые способны заменить токсичные препараты

7 естественных инсектицидов для мелких фермеров, которые способны заменить токсичные препараты

“Химия” на полях кажется незаменимой – была же причина, по которой изобретались искусственные средства против вредителей. Однако и потребителям, и аграриям всегда хотелось бы есть продукты и не переживать, что отравишься. Baker Tilly выяснил, чем заменить токсичные препараты.

Если бы в природе существовало средство от всех вредителей разом, то не было бы повода синтезировать искусственные препараты. Однако искусственные вещества тоже не оказалась спасением от всех проблем: если их неправильно применять, они вредят и человеку, и окружающей среде. Так что вместо частично помогающих искусственных препаратов можно использовать такие же эффективные натуральные заменители.

Мыльный раствор — самодельное средство против вредителей
Он поможет в истреблении тли и других сосущих сок вредителей: войлочника, клещей, цикадок, листоблошек, щитовок, трипс и белокрылок. Такое средство не токсично. Насекомые дохнут, потому что под мыльной пленкой им нечем дышать.Мыльные растворы продаются в садовых центрах и интернет-магазинах. Также их легко сделать самим: развести одну столовую ложку жидкого мыла на литр воды и залить в пульверизатор. Только при этом убедитесь, что взяли натуральное мыло – чтобы не повредить растению и не получить вредный химический эффект, от которого пытались избавиться.

Диатомовая земля — средство, которое работает только в сухую погоду
Диатомит – это останки окаменелых микробов и водорослей, измельченные в порошок. Когда насекомое по нему ползет, получается то же самое, как если бы человек полз по битому стеклу – диатомовая земля кромсает вредителей.

Порошок необходимо распылить на поверхности почвы вокруг уязвимых растений. Но следует помнить, что у этого средства есть существенный недостаток: оно работает только когда сухое. Так что его придется повторно применить всякий раз после дождя или полива грядок.

Фосфат железа — органическое средство от улиток и слизней
Этот полученный естественным путем минерал является активной составляющей органических средств против улиток и слизней. Препарат покрывается веществом, которое привлекает к себе вредителей, но железо внутри действует на них как яд. Эта форма железа, по крайней мере, в таких малых дозах, не вредна для людей, домашних животных или окружающей среды. И она лучше переносит дождь, чем диатомовая земля.

Многие другие средства для истребления улиток содержат более токсичную форму железа, триоксалатоферрат натрия, который не одобрен для органического сельского хозяйства, хотя его часто продают как натуральный продукт. Так что внимательно прочтите этикетку перед покупкой.

Bt — единоразовый удар в случае масштабного засилья вредителей
Bacillus Thuringiensis или Bt — это почвенная бактерия, которая токсична для многих насекомых, но не вредит людям, домашним животным, рыбе, птицам или другим представителям фауны. Она используется для борьбы с совками, бражниками и гусеницами, которые питаются капустными культурами.

Недостатком такого средства является то, что оно способно навредить и полезным насекомым. А вот у вредители на него быстро вырабатывается иммунитет. Так что использовать Bt лучше один раз, если паразитов стало уж очень много.

Paenibacillus popilliae — долго распространяется по почве, но эффект постоянный
«Родственник» Bt, он противостоит хрущику японскому, личинки которого подъедают корни травы, а взрослые особи – от овощей и фруктовых деревьев до роз и других декоративных растений.
Paenibacillus popilliae применяется только один раз. После того, как им засеяли почву, проходит несколько лет, чтобы средство распространилось и обеспечило полный контроль над личинками. Зато эффект от него постоянный.

Масло ним — средство, на которое у вредителей не вырабатывается иммунитет
Это ядовитым экстракт тропического азиатского дерева ним, препарат продается в садовых центрах. Он — один из лучших природных инсектицидов, который убивает всех: от капустника и ромбовика над землей до нематод и личинок жуков в почве.

Часто его требуется повторно распылять, чтобы добиться эффекта. Но зато оно не влияет на полезных насекомых, и вредители редко вырабатывают против него иммунитет, как это часто бывает с большинством химических инсектицидов.

Ромашник — средство от летающих насекомых, которое следует использовать осторожно
Эти растения, часто называемые просто ромашками, — одни из наиболее токсичных природных инсектицидов, хотя их применение разрешено в органическом сельском хозяйстве. Полученное из ромашника вещество убивает большинство насекомых при контакте и особенно эффективно против летающих насекомых, которых трудно достать другими средствами. Но оно не сработает против вредителей, которые живут под землей или глубоко в расщелинах растений, куда не проникает спрей.

Важно помнить, что это средство слегка токсично для людей, домашних и диких животных, так что при его использовании следует соблюдать меры предосторожности, обычно указанные на этикетке.

Но помните одно: даже если средство против вредителей и сделано из растения, это еще не значит, что оно нетоксично и полностью безопасно. К примеру, такие ботанические инсектициды как ротенон или экстракт никотина не только токсичней ромашника, но в некоторых случаях даже считаются более токсичными, чем некоторые из синтетических препаратов.

По материалам modern farmer

Насекомые позаимствовали гены у растений

Белокрылки защищаются от растительных токсинов с помощью гена, который сами стащили у растений много миллионов лет назад.

Мы не можем поделиться с другим человеком собственными генами. Точнее, можем, но для этого нужно родить ребёнка, который их унаследует. Но вот так, чтобы встретиться на улице, пожать друг другу руку и с рукопожатием получить себе в геном один-два гена – такое у нас невозможно.

Табачные белокрылки.(Фото: Stephen Ausmus / Wikipedia) 


Зато возможно у бактерий. Они передают генетическую информацию не только по вертикали, то есть по линии предок–потомок, но и по горизонтали, то есть просто друг другу, вне процесса размножения. Это называется горизонтальным переносом генов (ГПГ). Бактерии могут передавать и принимать чужую ДНК в ходе особого процесса, который называется конъюгацией, или же когда одна клетка поглощает другую, или же просто подбирая из окружающей среды ДНК, оставшуюся от другой клетки. Ген «осваивается» на новом месте и начинает работать на благо нового хозяина. Также горизонтальный перенос генов распространён у архей, хотя  механизмы его у них другие.


Что до животных, растений, грибов, то ещё совсем недавно считалось, что у них горизонтальный перенос генов случается очень и очень редко, если вообще есть. Но со временем стали появляться данные, что на самом деле он у них не так уж и редок. Так, мы писали о том, что грибы неоднократно заимствовали гены бактерий, благодаря чему смогли наладить симбиоз с растениями, а некоторые виды грибов даже научились с помощью бактериальных генов чувствовать гравитацию. Есть множество примеров того, как бактериальные гены заимствовали растения, членистоногие и едва ли не человек.



Но у бактерий позаимствовать ген, может быть, не так уж трудно. А вот были ли случаи, когда один сложный многоклеточный организм заимствовал ген у другого сложного многоклеточного? Как раз такой случай описан в статье в Cell, посвящённой табачной белокрылке. Это насекомое распространено буквально повсеместно, и особенно хорошо знакомо тем, кто занимается сельским хозяйством – потому что табачная белокрылка считается одним из самых опасных вредителей. Её личинки кормятся более чем на 600 видах растений, и не просто высасывают их сок, но и заражают растения множеством вирусов. Бывали случаи, когда белокрылка с вирусами полностью уничтожала урожай.


Сотрудники Китайской сельскохозяйственной академии обнаружили в геноме табачной белокрылки ген BtPMaT1. Тот же ген нашли ещё у двух видов белокрылок. Самое странное было в том, что ген BtPMaT1 до сих пор считался сугубо растительным. Объяснить это можно было либо тем, что ген BtPMaT1 был у общего предка растений и насекомых, но потом за миллионы лет эволюции растения его сохранили, а животные потеряли, за исключением трёх белокрылок. Но между растениями и насекомыми лежит огромная эволюционная пропасть, и такое развитие событий – что ген со времён общего растительно-животного предка почему-то остался только у единичных насекомых, которые, кстати говоря, не самые примитивные животные на свете – такое развитие событий авторы работы сочли неправдоподобным.


Альтернативой оставался горизонтальный перенос генов. Белокрылки с растительным геном возникли около 35 млн лет назад. Но у них есть близкородственные виды, которые сформировались около 80 млн лет назад, и у этих родственников растительного гена нет. Очевидно, ген появился у них между 80 и 35 млн лет. Как именно насекомые сумели встроить растительный ген в свою ДНК, пока неясно. Возможно, свою роль тут сыграли какие-нибудь вирусы, которые могут встраиваться в клеточную ДНК – правда, тогда придётся предположить, что эти вирусы более-менее нормально чувствовали себя как в растительных, так и в животных клетках, а предположить такое довольно сложно.


Но, так или иначе, белокрылки позаимствовали у растений весьма полезный для себя ген. Дело в том, что у растений есть разные системы защиты от вредителей. В частности, они могут синтезировать токсичные для насекомых фенолгликозиды. Но чтобы токсины не повредили самому растению, в растительных клетках есть специальный фермент, который расщепляет токсичные молекулы. Ген BtPMaT1 как раз этот фермент и кодирует.


Чтобы проверить, действительно ли BtPMaT1 защищает белокрылок от яда, исследователи ввели в растения томатов специальную молекулу, которая отключала ген BtPMaT1 – отключающая молекула попадала в насекомых , когда они сосали сок из растения. Из 2500 белокрылок, которые кормились на таком томате, не выжила ни одна. А из тех, которые кормились на обычном томате, погибло только 20%.


Это второй случай горизонтального переноса генов от растения к насекомым. Первый был описан в сентябре прошлого года в Scientific Reports, и тоже на примере белокрылок. Однако насчёт того растительного гена осталось много неясного – не очень понятно, зачем он понадобился насекомым. С новыми белокрылками и геном BtPMaT1 как раз всё намного яснее – он действительно им полезен. Возможно, борьба с белокрылками теперь станет успешнее: можно либо целенаправленно отключить у них этот ген, либо вывести новые сорта растений с модифицированным токсином, против которого защита белокрылок окажется бессильной.

Белокрылка. Борьба с вредителями

Белокрылка. Борьба с вредителями













ВикиЧтение

Борьба с вредителями
Иванова Наталья Владимировна









Белокрылка

Взрослое насекомое достигает всего 1,5 мм в длину. Тело белокрылки желтого цвета, имеется две пары прозрачных крыльев (рис. 4).

Рис. 4. Белокрылка

Встречается белокрылка на листьях огурцов, баклажанов, земляники и других растений. Любит влагу и тень. Период развития насекомого начинается весной, когда самка белокрылки откладывает яйца на участках растений, не освещенных солнечным светом. За лето самка способна вывести до четырех поколений насекомых. Поражение растения этим вредителем определяется по беловатому налету на листьях.







Данный текст является ознакомительным фрагментом.




Продолжение на ЛитРес








Читайте также








Белокрылка



Белокрылка
Взрослое насекомое достигает всего 1,5 мм в длину. Тело белокрылки желтого цвета, имеется две пары прозрачных крыльев (рис. 4).

Рис. 4. БелокрылкаВстречается белокрылка на листьях огурцов, баклажанов, земляники и других растений. Любит влагу и тень. Период






Белокрылка



Белокрылка
Белокрылка – опасный и очень распространенный вредитель. Она способна дать до 15 поколений за 1 год в тепличных условиях. В открытом грунте чаще всего питается помидорами и цветочными травянистыми растениями, а также огурцами, фасолью, сельдереем и






Белокрылка оранжерейная



Белокрылка оранжерейная
Данное насекомое относится к отряду равнокрылых, повреждает такие тепличные культуры, как огурец, томат, салат, болгарский перец и т. д. Это мелкое насекомое, имеющее туловище желтоватого цвета и две пары белых крыльев. Яйца мелкие, зеленоватые


































Белокрылка

Белокрылые — это полужесткие насекомые , которые обычно питаются нижней стороной листьев растений. Они составляют семейство Aleyrodidae , единственное семейство в надсемействе Aleyrodoidea . Описано более 1550 видов .

Aleyrodidae представляют собой семейство в подотряде Sternorrhyncha и в настоящее время составляют все надсемейство Aleyrodoidea, относящееся к надсемейству Psylloidea . Семейство часто упоминается в более старой литературе как «Aleurodidae» [2], но это младший синоним и, соответственно, неверный с точки зрения международных стандартов зоологической номенклатуры. [3]

Aleyrodidae — мелкие насекомые, большинство видов с размахом крыльев менее 3 мм и длиной тела от 1 мм до 2 мм. Многие из них настолько малы, что их размер затрудняет борьбу с ними в теплицах, поскольку их можно исключить только путем просеивания с очень мелкой сеткой; на самом деле они могут проникать в сетку настолько мелко, что многие из их естественных врагов не могут проникнуть за ними, так что неконтролируемые популяции белокрылки в теплицах быстро становятся подавляющими. Существуют некоторые виды «гигантской белокрылки», размер некоторых из которых может превышать 5 мм. Иногда это связано с половым диморфизмом, при котором один пол заметно крупнее другого. Такой диморфизм характерен для Sternorrhyncha, у которых, например, самцы большинства щитовок крошечные по сравнению с самками. Примечательно, однако, что у некоторых гигантских тропических видов самцы намного крупнее самок.[4]

Как и большинство мобильных Sternorrhyncha, взрослые Aleyrodidae имеют хорошо развитые усики, которые у большинства видов этого семейства семичлениковые. [5]

Как и у многих Hemiptera, есть два глазка , которые обычно у Aleyrodidae расположены на переднем крае сложного глаза. Сами составные глаза довольно примечательны: у многих есть отчетливая перетяжка между верхней и нижней половинами, а у некоторых видов наблюдается полное разделение. [5] Сложные глаза многих насекомых разделены на функционально и анатомически различные верхние и нижние области, но цель или происхождение адаптации у Aleyrodidae неясны. Степень разделения полезна для распознавания вида; [6] например, один из способов отличить взрослую Bemisia от Trialeurodesсостоит в том, что верхняя и нижняя части сложных глаз связаны одним омматидием у Bemisia, тогда как у Trialeurodes они полностью разделены. [7]

У обоих полов есть функциональные ротовые аппараты и две пары перепончатых функциональных крыльев; задние крылья не сильно уменьшены и не видоизменены в какие-либо крючковидные или жужжалоподобные структуры, которые встречаются у некоторых других Hemiptera, таких как многие из Coccoidea . Жилкование крыльев редуцировано, как у Psyllidae, только в целом гораздо сильнее. У многих родов имеется только одна заметная неразветвленная жилка в каждом крыле; однако крылья более крупных видов, таких как Udamoselis, имеют менее выраженное жилкование, хотя их жилки все еще простые и немногочисленные. [4]


Neomaskellia bergii , иллюстрирующая жилкование крыла и показывающая сосудистое отверстие над концом брюшка Жилкование у крупного вида Udamoselis более сложное.

как избавиться, профилактика, народные средства

Избавиться от белокрылки сложно, но можно. Народные средства и химические препараты помогут в борьбе с вредителем

Анисимов А.М.
  ⏳ 05-23-2018   06-25-2021

Белокрылка и личинки на листе. Бороться с белокрылкой можно только комплексными методами. Фото: Old Farmer’s AlmanacБелокрылка и личинки на листе. Бороться с белокрылкой можно только комплексными методами. Фото: Old Farmer’s Almanac

Белокрылка вредит растениям на протяжении всех стадий жизни — вредят личинки всех поколений и взрослые бабочки. Бороться с белокрылкой сложно — требуются комплексные меры борьбы и профилактики всеми доступными способами: биологические, химические, механические, народные.

Чаще всего белокрылка поселяется в теплицах и оранжереях, но не брезгует и комнатными растениями. Страдает от нашествия белокрылки и рассада овощных культур, особенно: перцы, томаты, картофель и др. Бальзамин, бегония, фуксия, пассифлора, пеларгония и другие комнатные цветы повреждает белокрылка, паразитируя на растениях вплоть до гибели.

Дело в том, что личинки белокрылки высасывают соки растений прикрепляясь к внутренней стороне листьев. Личинки высасывают сок избыточно, выделяя сладкую жидкость подобно тлям, на которой любят селиться сажистые грибы. Грибы в свою очередь покрывают поверхность листьев чёрным налетом, который ухудшает фотосинтез.

Работая сообща, грибы, бабочки и личинки белокрылки убивают растения быстро и без возможности восстановления. А если учесть, что каждое новое поколение белокрылки появляется каждые 25-28 дней, то за 3-4 месяца у вас в теплице будут жить несколько поколений белокрылки, одинаково вредных для растений.

Избавиться от паразитов можно только комплексными мерами, сочетая профилактику, карантин, биологические, химические и механические методы уничтожения и отпугивание вредителей.

Где появляется белокрылка. Как обнаружить вредителя

Определить белокрылку просто — это мелкие белые бабочки на нижней стороне листьев. Фото: Clemson University — USDA Cooperative Extension Slide Series, Bugwood.org

Белокрылка появляется в местах, где повышенная температура воздуха и влажность, недостаточная вентиляция и растения, растущие в стесненных условиях: в теплицах, оранжереях, парниках, городских квартирах и частных домах. Реже белокрылка буйствует на открытом пространстве — бабочкам мешает ветер и большое количество хищников, желающих полакомиться ими.

Белокрылка (лат. Aleurodidae, англ. Whitefly) — маленькая белая бабочка размером до 1,5 мм. Тело бабочки желтое, а крылья покрыты белой пыльцой. Бабочек можно обнаружить на листьях поврежденных растений, с наружной и внутренней стороны листьев. Если растение тряхнуть посильнее, то бабочки разлетаются в стороны.

Белокрылка многоядна — она может появиться на огурцах, а затем переключится на помидоры, сладкие перцы, фасоль, салат и цветочные растения.

Личинки белокрылки (англ. Whitefly larvae) наносят основной вред растениям, высасывая соки из листьев подобно тле. Личинок белокрылки можно обнаружить на обратной стороне листьев — они малоподвижные, бледно-зеленые, могут быть покрыты восковым налетом. Восковой налет появляется, когда личинки уже готовы превратиться в бабочек — в это время им не страшны пестициды и инсектициды.

Личинки, которые могут перемещаться по листьям, называют личинки-бродяжки. На этой стадии развития личинки белокрылки могут мигрировать с ветки на ветку, выбирая наиболее сочные листья. Питаясь личинки выделяют липкую, сахаристую, жидкость, которую любят муравьи и сажистые грибы. Грибы разрастаясь покрывают поверхность листьев черным налетом, которые не пропускает солнечный свет. Растение, и без того ослабленное утратой соков, лишается возможности нормального протекания фотосинтеза. Нет фотосинтеза — нет урожая, а при сильном повреждении листья желтеют и опадают.

Как бороться с белокрылкой

Уничтожить белокрылку очень сложно — в теплице одновременно живут и размножаются несколько стадий вредителя, поэтому среди них есть стадии, которые спокойно переносят травлю химическими препаратами.

Взрослые бабочки белокрылки легко переносят зимовку, зимуя в укромных местах или даже в почве. Как только почва прогреется до положительных температур бабочки выходят из укрытий и откладывают яйца на нижнюю сторону листьев, предпочитая молодые растения, например рассаду.

Яйца белокрылки легко обнаружить, приподнимая листья, чтобы проверить нижнюю сторону листьев. Обычно яйца белокрылки располагаются в виде полупрозрачных колец. Через краткий промежуток времени из яиц появляются личинки и начинают высасывать соки.

В течение 3-х недель личинки будут интенсивно питаться на растениях, мигрируя с листа на лист, а затем начнут покрываться восковым налетом, что делает их похожими на щитовок. В это время они сливаются с поверхностью обратной стороны листьев. Смыть водой их невозможно, да и для химикатов они недоступны.

Профилактика белокрылки

Белокрылку проще не допустить на растения, чем бороться с ней в поте лица. Именно в борьбе с белокрылкой раскрывается польза карантинных мероприятий. Да, карантин наше все!

Купили цветы в магазине — извольте поместить растения в карантин на две-три недели, отдельно от здоровых растений. Карантин даст возможность убедиться в наличии или отсутствии белокрылки на новом растении.

Нельзя переносить больные растения в теплицу по весне, также как нельзя переносить растения домой, после летнего пребывания в саду или в оранжерее — соблюдайте хотя бы непродолжительный карантин.

Осенняя дезинфекция теплиц, парников и оранжерей, с полным удалением растительных остатков, предупреждает появление белокрылки как нельзя лучше. Вредители ушедшие на зимовку гибнут, ведь они не рассчитывали на столь грубое вмешательство.

Обеззараживание грунта и глубокая перекопка почвы в ноябре, также полезны в деле профилактики белокрылки. Попутно надо удалять корни сорных растений вокруг теплицы, да и вокруг участка, где установлены сооружения закрытого грунт. Белокрылка неплохо размножается и на сорняках, но мы не имеем привычку осматривать их на предмет наличия вредителей.

Весной, в период активного лета бабочек белокрылки имеет смысл защитить теплицу при помощи мелкой сетки на окнах, фрамугах, форточках и дверных проемах.

Хорошо помогают от бабочек белокрылки обычные липкие ленты от мух. Белокрылки липнут к ним тысячами, сразу становясь хорошими. Известно, что хорошая белокрылка — мертвая белокрылка.

Желтая клеевая ловушка для белокрылки. Фото: Penny’s Garden

Опытным путем было установлено, что лучше всего белокрылка летит на ярко-жёлтый цвет, поэтому можно использовать липкие приманки желтого цвета. Ловушки надо развесить в местах скопления белокрылок — они с удовольствием полетят на желтую ловушку и прилипнут к ней. Некоторые рекомендуют ловушки Bona Forte, но на мой взгляд надо сначала испробовать дешевые средства, а затем переходить к дорогим, тем более, что результат виден сразу, в течение дня.

Клеевые ловушки для белокрылок развешивают вблизи растений. Фото:Penny’s Garden

Огородники знакомые с правилами пожарной безопасности могут в теплице на ночь зажечь лампу — насекомые привлеченные светом полетят на свет и обожгут крылья. Эффективность сомнительная, но как вариант можно попробовать.

При малом количестве насекомых можно опробовать водный метод изгнания белокрылки. Растения опрыскивают чистой водой, особенно с обратной стороны листьев, где скапливается белокрылка. Вода сбивает насекомых с растений, они падают на землю, а уж на земле делайте с ней что захотите. Можно просто разрыхлить почву на пару сантиметров и засыпать торфом, чтобы уничтожить вредителей.

Можно посадить в теплице несколько растений табака — белокрылка очень любит запах табака и летит на него, облепляя листья. Когда собралась приличная компания можно применить химические препараты опрыскав только табак, а не все растения в теплице.

Кстати, для борьбы с белокрылкой можно использовать обычный фумигатор с пластинкой от мух. Фумигатор надо установить в теплице или парнике. В домашних условиях такой метод не рекомендуется.

Повторюсь, все манипуляции с липкой лентой, ночным светом и опрыскиваниями водой хороши на стадии заселения белокрылки в вашу теплицу или парник. Когда бедствие дошло до масштабов эпидемии надо использовать более действенные методы.

Химические и биологические методы борьбы с белокрылкой

Сочетание химической и биологической атаки на белокрылку помогает снизить численность вредителей до минимальных значений, но обольщаться не стоит. Только комплексная, регулярная, обработка в сочетании с профилактикой поможет избавиться от белокрылки навсегда.

Для химической борьбы с белокрылкой рекомендуются препараты: Зета, Ровикурт, ИНТА-ВИР, Фуфанол и даже Карбофос. Также хорошо помогают препараты на базе Аверсектина (авермектина), например, Фитоверм в усиленной дозировке, порядка 10 мл на 1 литр воды. Фитоверм хорош тем, что убивает белокрылку наповал, а ягоды можно употреблять в пищу, хорошо помыв водой. Остальные препараты надо использовать согласно инструкции.

Запущенный случай. Белокрылка оккупировала растение. Народные средства уже не помогут

Кстати, чтобы продлить действие вышеописанных препаратов можно добавлять в раствор немного хозяйственного мыла, средства для мытья посуды или шампуня. Мыло и его аналоги помогают раствору лучше прилипать к листьям.

Ядовитые препараты против белокрылки типа Актелик, Актара, Конфидор, Командор, Танрек надо использовать только на открытом воздухе, либо с соблюдением всех предосторожностей, иначе вместе с белокрылкой вы навредите своему здоровью, надышавшись химией.

Народные методы борьбы с белокрылкой (биологические)

Биологические методы борьбы с белокрылкой заключаются в опрыскивании растений мыльным раствором и растительными препаратами: настоями одуванчика, чеснока, табака, тысячелистника и др.

Мыльный раствор применяется для опрыскивания растений и нанесения мыльной пены на листья, пораженные белокрылкой. Дегтярное мыло измельченное на терке растворяют в воде в соотношении 1:6 (100 грамм мыла на 600 мл воды). Без взбивания пены раствор мыла можно использовать для опрыскивания, а взбитую пену наносят кисточкой или губкой на обратную сторону листьев.

Мыло хорошо помогает от белокрылки, часто достаточно одной процедуры для полного исчезновения вредителей. Повторять обработку мыльным раствором можно через 7-10 дней, чтобы не обжечь листья.

Чесночный настой хорошо помогает при малом количестве белокрылки. Чтобы приготовить настой чеснока на терке натирают 2-3 зубчика чеснока и заливают литром воды, настаивают в темноте 24 часа, процеживают и приступают к опрыскиванию растений. Достаточно две-три обработки чесноком, чтобы сократить численность белокрылки.

Настой тысячелистника также эффективен для борьбы с белокрылкой: 100 грамм свежей травы тысячелистника залейте литром теплой воды, настаивайте в течение пары суток, отожмите и процедите. Опрыскивайте растений пульверизатором раз в неделю, два-три раза подряд.

Табачный настой помогает уничтожить малое количество белокрылки. Для приготовления табак из пачки крепких сигарет измельчают и заливают литром воды, с температурой +60-80°C и настаивают в темном месте в течение недели. Затем табачный настой надо процедить и опрыскивать пораженные белокрылкой растений с интервалом 3 дня до полного исчезновения паразитов.

Настой одуванчиков помогает на начальной стадии заселения белокрылки. Готовят настой из 50 грамм корневищ и листьев одуванчика (каждого по 50 гр.), сырье измельчают и заливают литром теплой воды, а затем настаивают в темном месте 5 дней. Готовый настой процеживают и опрыскивают растения два раза с недельным перерывом.

Часть 2 Фон Белокрылки — Биотехнология зеленых растений

Белокрылые — маленькие полужесткие насекомые, которые обычно питаются нижней стороной листьев растений. Описано более 1550 видов. Bemisia tabaci , широко известная как белокрылка серебристая или сладкая картофельная белокрылка, является одним из наиболее опасных вредителей томатов. Другая белокрылка, Trialeurodes vaporariorum , широко известная как тепличная белокрылка или тепличная белокрылка, обитает в регионах с умеренным климатом.Он часто встречается в теплицах, теплицах и других охраняемых садовых средах. Взрослые особи достигают 1-2 мм в длину, с желтоватым телом и четырьмя покрытыми воском крыльями, расположенными почти параллельно поверхности листа.

Белокрылки повреждают томаты напрямую, высасывая сок из листьев, и косвенно, передавая вирусы и производя липкий секрет, известный как медвяная роса, который является субстратом для роста грибов («сажистая плесень»). Это делает томаты неликвидными.

Trialeurodes vaporariorum стал важным с экономической точки зрения насекомым-вредителем тепличных овощных и декоративных культур в 1970-х годах.В последнее время он превратился в серьезного вредителя садоводства в районах южной Европы, где его можно объяснить увеличением числа вирусов. Колющие и сосущие части ротовой полости T. vaporariorum обеспечивают отличный способ передачи болезнетворных вирусов от одного растения к другому. Поскольку незрелые стадии белокрылки не переходят на новые растения, передача вируса является проблемой только для взрослых белокрылок.

Биологический контроль

Trialeurodes vaporariorum поражен видами Encarsia , Eretmocerus и грибковыми патогенами.Небольшая хальцидная оса, Encarsia formosaI , коммерчески производится и используется для биологической борьбы в теплицах.

Селекция томатов на устойчивость к белокрылке: создание

Помидоры, устойчивые к белокрылке ( B. tabaci ), являются ответом на многие проблемы, вызванные белокрылкой, и важной частью комплексного подхода к борьбе с вредителями. В этом задании мы будем следовать инструкциям исследователя помидоров, соответственно. селекционер должен принять меры для внесения устойчивости в коммерческие сорта томатов в процессе селекции.Это традиционный подход, и генетическая модификация (ГМ) не используется. Селекционер должен предпринять следующие необходимые шаги:

  • Разработать надежный метод скрининга устойчивости белокрылки
  • Поиск лучшего донорского растения с устойчивостью белокрылки в диких томатах, которые можно скрестить с томатами
  • Создание скрещиваний между устойчивыми дикими томатами растения и восприимчивые культивируемые растения томатов
  • Развитие сегрегационных популяций
  • Анализ сцепления с использованием данных фенотипирования и генотипирования
  • Применение связанных молекулярных маркеров в программе селекции для получения новых коммерческих сортов

Фон вопроса:

2.1 Можете ли вы найти изображение растения томата, поврежденного белокрылкой?

2.2 Какие вирусы могут передавать белокрылки растениям томатов?

2.3 Где можно найти дикие томаты?

2.4 Каков уровень плоидности растения томата?

2.5 Какова стратегия разведения томатов?

Разнообразие и локализация бактериальных эндосимбионтов из видов белокрылки, собранных в Бразилии

Abstract

Белокрылые (Hemiptera: Aleyrodidae) являются насекомыми-вредителями, сосущими соки, и некоторые из них наносят серьезный ущерб сельскохозяйственным культурам путем прямого кормления и передачи вирусов растений.Белокрылки поддерживают тесные ассоциации с бактериальными эндосимбионтами, что может существенно влиять на их биологию. У всех видов белокрылки есть первичный эндосимбионт и множество вторичных эндосимбионтов. В этом исследовании мы обследовали 34 популяции белокрылки, собранные в штатах Сан-Паулу, Баия, Минас-Жерайс и Парана в Бразилии, на предмет идентификации видов и заражения вторичными эндосимбионтами. Секвенирование митохондриального гена цитохромоксидазы I показало существование пяти видов белокрылки: белокрылки сладкой картофельной белокрылки , Bemisia tabaci B (недавнее название — Ближний Восток — Малая Азия 1 или MEAM1), белокрылки тепличной , Trialeurodes vaporariorum , B.tabaci Биотип (недавно названный New World 2 или NW2), собранный только у молочай, белокрылки Acacia Tetraleurodes acaciae и Bemisia tuberculata , оба были обнаружены только на маниоке. Секвенирование генов рРНК показало, что Hamiltonella и Rickettsia были широко распространены во всех популяциях MEAM1, тогда как Cardinium был близок к фиксации только в трех популяциях. Удивительно, но некоторые особи MEAM1 и одна популяция NW2 были инфицированы Fritschea.Arsenopnohus был единственным эндосимбионтом, обнаруженным у T. vaporariorum. В популяциях T. acaciae и B. tuberculata , собранных из маниоки, Wolbachia было зафиксировано в B. tuberculata и было широко распространено в T. acaciae . Интересно, что в то время как B. tuberculata было дополнительно инфицировано Arsenophonus, T. acaciae было инфицировано Cardinium и Fritschea. Fluorescence in situ Анализ гибридизации на репрезентативных особях показал, что Hamiltonella , Arsenopnohus и Fritschea были локализованы внутри бактериома, Cardinium и Wolbachia имели двойные паттерны локализации бактерий iome и снаружи. показал строгую локализацию вне бактериома.Это исследование является первым исследованием популяций белокрылых, собранным в Бразилии, и дает более глубокое понимание сложности заражения вторичными эндосимионтами белокрылки.

Образец цитирования: Марубаяши Дж. М., Клиот А., Юки В. А., Резенде Дж. Э. М., Краузе-Сакате Р., Паван М. А. и др. (2014) Разнообразие и локализация бактериальных эндосимбионтов из видов белокрылки, собранных в Бразилии. PLoS ONE 9 (9):
e108363.

https://doi.org/10.1371/journal.pone.0108363

Редактор: Костас Бурцис, Международное агентство по атомной энергии, Австрия

Поступила: 2 мая 2014 г .; Принята к печати: 25 августа 2014 г .; Опубликован: 26 сентября 2014 г.

Авторские права: © 2014 Marubayashi et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Авторы подтверждают, что все данные, лежащие в основе выводов, полностью доступны без ограничений. Все соответствующие данные включены в документ.

Финансирование: JMM получила стипендию от Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) номер стипендии № 9521 / 11-9.Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: MG заявляет, что они являются членом редакционной коллегии PLOS ONE и что это не влияет на соблюдение авторами всех политик PLOS ONE в отношении обмена данными и материалами.

Введение

Белокрылка, Bemisia tabaci Геннадий (Hemiptera: Aleyrodidae) — одно из самых разрушительных насекомых-вредителей 20 века, космополитично и многоядно [1].В дополнение к прямому повреждению, вызванному питанием флоэмой растений и секрецией пади, B. tabaci известен как переносчик более 100 вирусов растений из разных родов, включая Begomovirus, Crinivirus, Carlavirus и другие [2], [3].

B. tabaci считается комплексом криптических видов, которые также иногда называют «биотипами» и характеризуются как генетические варианты или гаплотипы, различающиеся по молекулярным и биологическим характеристикам [4].На основании молекулярных и биологических аспектов B. tabaci классифицируется примерно на 35 видов [1], [5], [6], [7]. Например, биотипы B и B2 принадлежат к новому виду, получившему название Ближнего Востока и Малой Азии 1 (MEAM1); биотипы Q, J, L, Африка к югу от Сахары, биотипы с серебристыми листьями и Средиземноморье принадлежат к группе, называемой Африка / Ближний Восток / Малая Азия, а биотипы, известные как A, C, D, F, Jatropha, N , R и Sida принадлежат к группе Нового Света, в которую входят виды Нового Света (NW) и Нового Света 2 (NW2) [1], [5].На основе новой классификации виды MEAM1, NW и NW2 недавно были исследованы в Бразилии [8]. Помимо B. tabaci, в Бразилии известно других видов белокрылки, таких как Bemisia tuberculata , Tetraleurodes acaciae и Trialeurodes vaporariorum . Например, было показано, что B. tuberculata колонизирует растения маниоки в штатах Сан-Паулу, Мату-Гросу и Рио-де-Жанейро [9], [10], [11], в то время как тепличная белокрылка T.vaporariorum , был связан со вспышками в 2003 г. на садовых и декоративных культурах в штате Сан-Паулу [12].

Белокрылки, как и многие другие членистоногие, обычно инфицированы бактериальными эндосимбионтами, которые могут влиять на их биологию и взаимодействие с другими организмами или окружающей средой [13]. У белокрылки есть первичный обязательный эндосимбионт Portiera aleyrodidarum [14], [15], который необходим для сохранения вида и для дополнения несбалансированной диеты насекомого, состоящей в основном из сахаров из флоэмы растений.Помимо Portiera, в популяциях белокрылок со всего мира, как сообщается, обитает разнообразный набор факультативных вторичных эндосимбионтов, которые не являются существенными для сохранения вида, в том числе Gammaproteobacteria Arsenophonus (Enterobacteriales), Hamiltonella (Enterobacteriales) [16 ], [17], Fritschea (Chlamydiales) [18], Cardinium (Bacteroidetes) [19], альфа-протеобактерии Rickettsia (Rickettsiales) [20], Wolbachia [21] [21] ] и Ориентиеподобный организм [23].Несколько популяций белокрылки по всему миру были обследованы на предмет заражения эндосимбионтами, и часто наблюдалась четкая связь между биотипами и вторичными симбионтами. Например, в исследуемых популяциях из Израиля Hamiltonella была обнаружена только в биотипе B, Wolbachia и Arsenophonus — только в биотипе Q, а Rickettsia — в обоих биотипах [24]. Ни одно население из Израиля не было инфицировано Fritschea или Cardinium.Fritschea был обнаружен только в биотипе A (NW2) из ​​США [25], и только Arsenophonus были связаны с T. vaporariorum [16]. Cardinium был обнаружен в популяциях биотипов B и Q из Китая [26], популяциях Q из Хорватии [27], [28] и Франции [29]. Дополнительные популяций T. vaporariorum были проанализированы из Хорватии и, как сообщалось, были инфицированы Portiera и Hamiltonell a в дополнение к ранее зарегистрированной инфекции Arsenophonus [27].Были исследованы другие виды белокрылки, такие как белокрылка ясеня Siphoninus phillyreae (Haliday) из Хорватии, и были обнаружены такие же эндосимбионты, как и другие виды белокрылки [28].

В текущем исследовании различные популяции, представляющие пять видов белокрылки, собранные в четырех штатах Бразилии, были обследованы на предмет заражения вторичными эндосимбионтами, и идентифицированные эндосимбионты были локализованы у взрослых особей с помощью флуоресцентного анализа in situ гибридизации (FISH).Результаты свидетельствуют о новых инфекциях эндосимбионтами у видов белокрылки, о которых ранее не сообщалось, что еще больше усложняет уже известные бактериальные инфекции эндосимбионтов среди популяций белокрылки во всем мире.

Результаты

Идентификация видов белокрылки

Всего в этом исследовании было проанализировано 34 популяции. Популяции были собраны в четырех штатах Бразилии в период 2010–2012 гг., Из разных мест и растений-хозяев, как показано в таблице 1.Различное количество особей, в зависимости от наличия, из каждой популяции было проанализировано на предмет заражения шестью различными вторичными эндосимбионтами: Hamiltonella, Rickettsia, Cardinium, Wolbachia, Arsenophonus и Fritschea . ПЦР, нацеленная на Portiera, первичных эндосимбионтов, была проведена в качестве положительного контроля для реакции. Для определения видов и биотипов белокрылки были дополнительно выполнены ПЦР и анализ секвенирования с использованием амплификации и секвенирования гена COI и микросателлитных праймеров, как подробно описано в разделе о методах.Двадцать две популяции были идентифицированы как видов B. tabaci MEAM1 (биотип B), а одна популяция была идентифицирована как NW2 (таблица 1). Другими видами белокрылки, которые были идентифицированы на основе амплификации гена COI, являются: четыре популяции B. tuberculata , три популяции T. acaciae и четыре популяции T. vaporariorum (Таблица 1).

B. tabaci Инфекция вторичными эндосимбионтами

Индивидуальных белокрылок анализировали на инфицирование шестью вторичными эндосимбионтами с использованием специфичных для рода праймеров (таблица 2), и каждого индивидуума тестировали на инфицирование первичными эндосимбионтами Portiera в качестве положительного контроля.На рисунке 1 показано инфицирование эндосимбионтами всех обследованных индивидуумов из каждой популяции и смешанные инфекции с множественными эндосимбионтами внутри каждого индивидуума. Например, были протестированы десять особей из популяции, собранной в Вотупоранга из капусты, и все эти особи были коинфицированы Hamiltonella и Rickettsia , в то время как другие вторичные эндосимбионты не были обнаружены. Наиболее распространенной коинфекцией, наблюдаемой в исследуемых популяциях, были люди, дважды инфицированные Hamiltonella и Rickettsia (64.20%). Большинство особей из трех популяций, собранных в Итапеве, Дом Базилио и Лондрина, были одновременно инфицированы Hamiltonella, Rickettsia и Cardinium , а распространенность трехкратно инфицированных особей составила 14,22%. Также наблюдались другие одиночные, двойные и тройные инфекции из популяций B. tabaci MEAM1, включая людей, инфицированных только Rickettsia или только Hamiltonella, человек, инфицированных Hamiltonella и Fritschea (Patos de Minas) и два человека, инфицированные Hamiltonella, Rickettsia и Fritschea .Интересно, что только три человека из 204 проанализированных лиц не были инфицированы какими-либо вторичными эндосимбионтами, в то время как остальные были инфицированы по крайней мере одним эндосимбионтом (частота инфицирования 98,04%). 91,67% людей были инфицированы Rickettsia , 87,25% — Hamiltonella, — 14,22% — Cardinium , 4,90% — Fritschea . Четыре человека в единственной популяции, идентифицированной как NW2, были инфицированы Hamiltonella, Cardinium и Fritschea .

Рис. 1. Индивидуальная и смешанная инфекция вторичными симбионтами в популяциях B.tabaci , собранных в этом исследовании.

Были собраны и исследованы двадцать две популяции MEAM1 (биотип B) и одна популяция NW2 (биотип A). Каждая ячейка представляет одну популяцию. Вертикальные столбцы представляют различные протестированные симбионты, как указано в основании каждого столбца, а каждый горизонтальный столбец представляет одного человека, который был протестирован на наличие шести разных симбионтов.Заштрихованные прямоугольники соответствуют положительному результату заражения тестируемым симбионтом. Географическое происхождение популяций, виды и количество протестированных особей указаны в верхней части каждого поля (полные имена см. В Таблице 1).

https://doi.org/10.1371/journal.pone.0108363.g001

Заражение T. vaporariorum, T. acacia и B. tuberculata вторичными эндосимбионтами

Распространенность T. vaporariorum была намного ниже, чем B.tabaci в обследованных регионах. Тридцать пять T. vaporariurom особей из четырех различных регионов штата Сан-Паулу были протестированы на заражение шестью различными эндосимбионтами (рис. 2). Первичный эндосимбионт Portiera был обнаружен у всех индивидуумов, в то время как среди вторичных эндосимбионтов только Arsenophonus был обнаружен как единичная инфекция (94,28% протестированных особей) у всех индивидуумов, за исключением одного индивидуума из Апиаи и второго человека из Bom sucesso. правда, оба не были инфицированы ни одним из вторичных эндосимбионтов (рис.2). В ходе проведенного нами исследования были обнаружены еще два вида белокрылки. Оба вида, B. tuberculata и T. acaciae , были обнаружены только на растениях маниоки (таблица 1). Четыре популяции B. tuberculata и три T. acacia были проанализированы на инфекции эндосимбионтами.

Рис. 2. Индивидуальные и смешанные инфекции вторичными эндосимбионтами у дополнительных видов белокрылки, проанализированных в этом исследовании.

Четыре популяции T.vaporariorum (T. v.) , 4 популяции B. tuberculata ( B. tub.) и 3 популяции T. acaciae ( T. a.) были собраны и проанализированы в этом исследовании ( Более подробную информацию см. В легенде к рисунку 2).

https://doi.org/10.1371/journal.pone.0108363.g002

Из протестированных B. tuberculata человек 96,97% были инфицированы по крайней мере одним эндосимбионтом, в то время как только один человек не был инфицирован каким-либо вторичным эндосимбионтом ( Инжир.2). Wolbachia и Arsenophonus были обнаружены при единичных или смешанных инфекциях во всех четырех проанализированных популяциях. Arsenophonus был наиболее распространенным эндосимбионтом с частотой инфицирования 81,82%, а Wolbachia с уровнем инфицирования 84,85%. Интересно, что Fritschea появлялся в 15,15% случаев заражения, а Cardinium — в 12,12%, и оба появлялись в единичных или смешанных инфекциях. Один человек был инфицирован Fritschea, — один человек — только Fritschea и Cardinium , оба были собраны в Вотупоранге, а один человек, собранный из Assis, был инфицирован четырьмя эндосимбионтами, обнаруженными в B.tuberculata : Wolbachia, Arsenophonus , Fritschea и Cardinium .

Среди популяций T. acaciae обнаружено три эндосимбионта: Wolbachia, Cardinium и Fritschea. Все исследованные лица были инфицированы по крайней мере одним эндосимбионтом (рис. 2). Wolbachia , по-видимому, фиксируется в популяциях T. acaciae , причем все особи являются носителями этого эндосимбионта. Тройное инфицирование тремя обнаруженными эндосимбионтами было наиболее распространенным типом инфицирования — 85.71% людей, показывающих эту картину инфекции. Среди 28 протестированных индивидуумов только один человек показал однократное заражение Wolbachia, один человек показал двойное заражение Wolbachia и Cardinium и один человек показал двойное заражение Wolbachia и Fritschea (рис.2).

Локализация вторичных эндосимбионтов у белокрылок, собранных в Бразилии

Все обнаруженные вторичные эндосимбионты в популяциях, собранных в Бразилии, были локализованы на всех стадиях развития с использованием анализа FISH.Наблюдались все ранее описанные паттерны локализации эндосимбионтов белокрылки от полного заключения внутри бактериома до полной локализации вне бактериома, а также паттерны двойной локализации внутри и вне бактериома.

Четыре эндосимбионта были обнаружены у B. tabaci: Hamiltonella, Rickettsia, Cardinium и Fritschea. Hamiltonella была обнаружена только у видов B. tabaci MEAM1 и NW2 (рис.1), и эксперименты по локализации показали, что эта бактерия всегда ограничена бактериосомными клетками, локализуясь совместно с Portiera, — первичными эндосимбионтами (рис.3). Клетки Hamiltonella были локализованы в виде небольших участков внутри клеток бактериоцитов и не занимали всю полость клетки. Такая локализация наблюдалась на всех стадиях развития: яйца, нимфальные стадии и взрослые особи. Риккетсия была локализована вне бактериома и занимала большую часть полости тела, но не клетки бактериоцитов. Такая локализация наблюдалась на всех этапах развития. Внимательное изучение образцов локализации Rickettsia показало, что она поражает многие органы.

Рисунок 3. FISH отобранных образцов, собранных в этом исследовании для конкретной локализации вторичных эндосимбионтов.

A – B: РЫБЫ Arsenophonus (желтый) и Portiera (красный) у T. vaporariorum в ярком поле (A) и темном поле (B). C – D: FISH Fritschea (синий) и Portiera (красный) в NW2 в ярком поле (C) и темном поле (D). E – F: FISH Hamiltonella (зеленый) и Portiera (красный) в MEAM1 в ярком поле (E) и темном поле (F).G – H: РЫБЫ Rickettsia (синий) и Portiera (красный) в MEAM1 при ярком поле (G) и темном поле (H). I – J: РЫБЫ Cardinium (синий) и Portiera (красный) в T. acaciae в ярком поле (I) и темном поле (J). K – L: РЫБА Wolbachia (синий) в B. tuberculata в ярком поле (K) и темном поле (L). Т: яичко.

https://doi.org/10.1371/journal.pone.0108363.g003

Два дополнительных эндосимбионта, локализованных внутри бактериома, — это Arsenophonus и Fritschea.Arsenophonus , который не был обнаружен у B. tabaci и T. acaciae, , но присутствовал в T. vaporariorum и B. tuberculate , локализованных у обоих видов внутри клеток бактериоцитов с Portiera, первичным эндосимбионт. Arsenophonus , в отличие от других эндосимбионтов, локализовался в виде пятен и возник в виде палочковидных структур. Fritschea была локализована у всех протестированных видов белокрылки, за исключением T.vaporariorum также внутри бактериальных клеток, однако сигнал локализации был слабым, и концентрация бактерии казалась очень низкой.

Два эндосимбионта, которые были обнаружены в этом исследовании, Wolbachia и Cardinium , демонстрировали двойную структуру локализации внутри и вне бактериома (рис. 3). Эти две бактерии были обнаружены у B. tabaci, B. tuberculata и T. acaciae. Картина локализации у трех видов не различалась для двух эндосимбионтов; однако оба симбионта оказались в очень низкой концентрации.Как и в предыдущих сообщениях, Wolbachia локализуется по окружности или внутри бактериоцитов с первичным эндосимбионтом. Кроме того, хотя Wolbachia можно найти вне клеток бактериоцитов, он всегда локализован рядом с этими клетками в брюшной полости и не виден в других частях насекомого, таких как грудная клетка и голова.

Обсуждение

В этом исследовании впервые представлен комплексный обзор видов белокрылки, обнаруженных в четырех штатах на востоке Бразилии: Сан-Паулу, Парана, Баия и Минас-Жерайс.Всего было собрано 34 популяции с разных растений-хозяев и протестировано на идентичность видов белокрылки и инфекции бактериальными эндосимбионтами с использованием ПЦР и секвенирования (таблицы 1 и 2). Большинство из популяций B. tabaci было собрано в Сан-Паулу, в то время как в остальных штатах было собрано лишь несколько популяций. Двадцать три из собранных популяций в четырех штатах были идентифицированы как виды MEAM1, четыре были T. vaporariorum, четыре — B. tuberculate, три популяции были идентифицированы как T.acaciae и одна популяция как NW2. Все другие виды белокрылки, не относящиеся к MEAM1, были собраны только в штате Сан-Паулу. Популяции MEAM1 были собраны с разных растений-хозяев, что позволяет предположить, что ни одно из растений-хозяев не было предпочтительным хозяином для этого вида, что подчеркивает его известную многофагность.

B. tabaci популяций, собранных в этом исследовании, все принадлежали к виду MEAM1, и только одна популяция, собранная из молочайников, была идентифицирована как NW2 (Таблица 1). Было обнаружено, что популяции MEAM1 содержат Hamiltonella, Rickettsia, Cardinium , и, что удивительно, некоторые люди также были инфицированы Fritschea , который также заразил всех индивидуумов из единственной популяции NW2.Идентичность Fritschea была подтверждена секвенированием амплифицированных фрагментов гена 23 S рРНК. Предыдущие исследования видов белокрылки в некоторых частях мира, которые включали MEAM1, MED и другие, например, в Израиле [24], Китае [26], Хорватии [27], [28] и некоторых странах Европы и Африки [29], выявили, что Fritschea не заражает ни одну из обследованных популяций, и что эта бактерия была зарегистрирована только из США как инфицированная биотипом A (NW) [18]. Для оценки изменчивости бактериальных видов, инфицированных исследуемыми популяциями, исследованными в этом исследовании, были получены последовательности генов 16 S или 23 S рРНК.Результаты показали, что для каждого вида бактерий не наблюдалось вариабельности, и вполне вероятно, что в исследуемых популяциях в этом исследовании был обнаружен один штамм каждой бактерии, что указывает на то, что единичные инфекции или единичные интродукции белокрылки, инфицированной этими эндосимбионтами, являются источником заражения. наблюдаемые бактериальные популяции. Например, последовательности из Fritschea , которые были обнаружены в MEAM1 и NW2, показали 100% гомологию, что позволяет предположить, что один и тот же штамм Fritschea колонизирует оба вида белокрылки, что может указывать на горизонтальный перенос или предковую одиночную инфекцию Fritschea между два вида при совместном использовании растения-хозяина [34], [35].Эндосимбионтов можно вводить в сосудистую систему растений, из которой они могут быть приобретены и закреплены в новых хозяевах членистоногих [36]. Недавнее исследование показало, что слюнные железы действительно могут быть инфицированы эндосимбионтами, как в случае Cardinium в Scaphoideus titanus [37], [38]. Дополнительное исследование показало, что Rickettsia белокрылки может передаваться горизонтально через сосудистую систему растений [39], что свидетельствует о его способности колонизировать отдаленные виды насекомых через обычных растений-хозяев.

Было обнаружено, что популяций T. vaporariorum , собранных в Сан-Паулу, инфицированы только Arsenophonus, в отличие от популяций T. vaporariorum , ранее протестированных в Хорватии, которые были инфицированы Hamiltonella и Arsenophonus [27] , [28]. Единственный другой вид белокрылки, который был инфицирован Arsenophonus в этом исследовании, — это B. tuberculata, , который колонизирует только растения маниоки.Трудно предположить, как этот симбионт заражает этих далеких родственников насекомых, и опять же, это может быть недавний горизонтальный перенос или заражение древнего предка. Другими штаммами симбионтов, которые были общими между отдаленно родственными видами белокрылки, собранными в этом исследовании, являются Cardinium , которые были общими между MEAM1, NW2, B. tuberculata и T. acaciae, и Fritschea , которые также были общими для всех белокрылок. виды, кроме T.vaporariorum. Другие примеры включают заражение B. tuberculata Wolbachia, Cardinium и Fritschea, заражение B. tabaci MEAM1 Hamiltonella, Rickettsia, Cardinium и Fritschea, инфекцию NW2ella Fritschea и заражение T. acaciae Wolbachia, Cardinium и Fritschea. Некоторые популяции показали очень низкие уровни инфицирования некоторыми из симбионтов, например инфицирование некоторых популяций MEAM1 Fritschea и Cardinium. Этот результат можно объяснить недавним появлением новых популяций белокрылки со специфическими инфекциями симбионтов в Бразилии или нестабильностью или редкостью некоторых комбинаций белокрылки и эндосимбионта при определенных условиях, таких как климат, хищничество, методы ведения сельского хозяйства и многое другое. Несколько внутренних факторов могут влиять на максимальную частоту инфицирования одних и тех же людей. Эти факторы включают конкуренцию за пространство и ресурсы между двумя или более эндосимбионтами [33], [40] или, наоборот, позитивное взаимодействие, кооперацию и зависимость одного эндосимбионта от другого [41].Другим важным фактором является реакция насекомого-хозяина на присутствие этих симбионтов, которая в большинстве случаев влияет на бактериальное сообщество, проживающее внутри этого хозяина. В общем, заражение вторичными симбионтами без достижения фиксации предполагает, что эти бактерии не являются существенными для насекомого, в то время как бактерии, достигшие фиксации или близкие к фиксации, указывают на мутуалистические отношения. Например, было показано, что Hamiltonella заразила только 40% протестированных особей гороховой тли из Калифорнии, в то время как только 0–40% были инфицированы Rickettsia [42], [43], [44], [45], [46], [47]. Hamiltonella достигла фиксации в популяциях B. tabaci , как и те, что были протестированы в Израиле [24], [27], [28], [29], что указывает на некоторые мутуалистические или обязательные отношения с насекомым или первичным эндосимбионтом как . Hamiltonella всегда локализовалась внутри бактериомных клеток с первичным эндосмбионтом Portiera. Такие взаимодействия могут дополнять диету хозяина, улучшать его физическую форму или справляться с условиями окружающей среды, такими как устойчивость к экстремальным условиям.

B. tuberculata и T. acaciae ранее не исследовались на предмет заражения вторичными эндосимбионтами. Оба вида имеют строго одно и то же растение-хозяин и могут быть обнаружены в симпатрии на маниоке, и не были обнаружены на других растениях-хозяевах. Хотя неизвестно, когда эти два вида стали специализироваться на маниоке в Бразилии, неудивительно, что у обоих видов есть общие вторичные эндосимбионты, включая Wolbachia, Cardinium и Fritschea. Интересно, что Fritschea ранее сообщалось только от биотипа А [18], и это первый случай, когда сообщается, что этот Chlamydia заражает другие виды белокрылки с такой высокой распространенностью, иногда достигая фиксации или почти фиксации, например в случае популяций T. acaciae, протестированных в данном исследовании. Такая высокая распространенность предполагает тесную связь между Fritschea и T. acaciae, и может указывать на важную роль, которую этот хламидиоз играет в биологии T.акации. У B. tuberculata, , однако, Fritschea появился только у 14% протестированных особей, а некоторые популяции не укрывали его, например, популяции, собранные у C. Mota и Cardoso (рис. 2). Поскольку T. acaciae и B. tuberculate имеют одного и того же растения-хозяина, они также могут иметь общих паразитоидов. Ранее было показано, что Rickettsia из B. tabaci были приобретены тремя паразитоидами белокрылки Eretmocerus emiratus , Eretmocerus eremicus и Encarsia pergandiella , однако не были переданы вертикально этим 48 видам потомству [48] этих паразитов. .Это исследование продемонстрировало потенциальные пути и барьеры для горизонтальной передачи симбионтов через трофические уровни и предполагает, что обычные симбионты между T. acaciae и B. tuberculate , наблюдаемые в нашем исследовании, могут также переноситься горизонтально через паразитирование обычными паразитоидами белокрылки. , как и исследованные в данной работе [48]. Аналогичным образом, Wolbachia , как было показано, передается паразитической осе Leptopilina boulardi от инфицированного хозяина Drosophila simulans и впоследствии подвергается уменьшающейся вертикальной передаче в этом новом виде хозяина [49].

Arsenophonus был единственным эндосимбионтом, заразившим популяций B. tuberculata , но не появился у T. acaciae (рис. 2). Эта бактерия была зафиксирована в некоторых популяциях, таких как Assis, близка к фиксации, например, у C. Mota и Cardoso, и появилась только у одного человека, как в случае популяций, собранных из Вотупа (рис. 2). Arsenophonus участвовали в репродуктивных манипуляциях у широкого круга видов насекомых, индуцируя фенотип уничтожения самцов [50], и, возможно, действовали так же у B.tuberculata. Эта бактерия была локализована внутри бактериосомных клеток с помощью FISH-анализа (рис. 3), предполагая, что она передается строго вертикально, и это может быть причиной ее отсутствия у T. acaciae , которые колонизируют те же растения-хозяева.

В дополнение к Arsenophonus , который был локализован в клетках бактериоцитов, другие эндосимбионты, обнаруженные в этом исследовании, были локализованы в репрезентативных образцах. Hamiltonella и Fritschea, , помимо Arsenophonus, были строго локализованы внутри бактериальных клеток (рис.3) в MEAM1, NW2, B. tuberculata и T. acaciae . Cardinium и Wolbachia наблюдались внутри и снаружи клеток бактериоцитов (рис. 3), но проявлялись в очень низких концентрациях. Только Rickettsia появлялись строго вне бактериома и никогда не наблюдались внутри (рис. 3). Эти паттерны локализации проявлялись на всех стадиях развития: яйца, нимфы и взрослые особи. Эндосимбионты, которые строго локализованы в бактериоцитах, передаются вертикально и, таким образом, могут вносить вклад в приспособленность своего хозяина [54], подобно эффектам, вызываемым симбионтами, локализованными вне бактериоцитов, такими как Wolbachia и Rickettsia .Однако эти эндосимбионты с меньшей вероятностью будут манипулировать воспроизводством своего хозяина, поскольку для этого требуется вторжение в репродуктивные органы вне бактериома. Wolbachia и Cardinium показали двойные паттерны локализации. Они могут быть обнаружены у многих отрядов насекомых с разной частотой и действительно связаны с репродуктивными нарушениями [51], [53]. Кроме того, Wolbachia — это широко изученный симбионт, который, как было показано, вызывает множество эффектов на своих хозяев-членистоногих, включая воздействие на хозяев видов комаров, эффект, который недавно был использован для контроля распространения вируса Денге [55], [56] ].Низкая концентрация Wolbachia и его двойная локализация в B. tuberculata и T. acaciae предполагает, что он может играть роль в репродуктивных манипуляциях; однако нельзя исключать другие эффекты, и для подтверждения этого предположения требуются дополнительные исследования.

В отличие от остальных эндосимбионтов, обнаруженных в этом исследовании, только Rickettsia показали рассеянный паттерн локализации и наблюдались за пределами бактериома, инфицирующего ткани в брюшной полости, грудной клетке и голове, как было недавно показано [57]. Rickettsia , как было показано, манипулирует воспроизводством хозяина у многих членистоногих [50], [52], и это хорошо согласуется с его паттерном локализации у B. tabaci. Ранее было показано, что Rickettsia проявляет два разных фенотипа локализации: рассеянный по всему телу и ограниченный бактериомом [33]. Эти два фенотипа никогда не наблюдались вместе у одних и тех же людей; однако одно исследование, в котором тестировались популяции из Хорватии, показало, что эти два фенотипа наблюдались у одного и того же человека [27].Наши результаты FISH показали наличие только рассеянного фенотипа в популяциях MEAM1, где было обнаружено Rickettsia (рис. 2). Этот фенотип отличается от обязательного Rickettsia у буклисов, у которого было обнаружено, что он проявляется с обоими фенотипами у одного и того же индивидуума [58]. Недавнее исследование продемонстрировало, что Rickettsia трансовариально передается B. tabaci последующему поколению путем вторжения в развивающиеся ооциты и фолликулярные клетки, таким образом, попадая в индивидуумы, которые развиваются из этих ооцитов [57]. Rickettsia , как было недавно показано в Аризоне, демонстрирует высокую распространенность и почти фиксацию в естественных популяциях. Более позднее исследование также показало, что Rickettsia- инфицировали самок B. tabaci демонстрируют высокие преимущества приспособляемости, такие как повышенная плодовитость, большая выживаемость и манипуляции с воспроизводством хозяина за счет производства более высокой доли дочерей [59]. Недавнее исследование показало, что Rickettsia горизонтально передается от человека к человеку через растение-хозяин [39].Дополнительные исследования показали, что присутствие Rickettsia в популяциях B. tabaci влияло на реакцию белокрылки на тепловой стресс, принося пользу ее хозяину при высоких температурах [60], а также повышало восприимчивость белокрылки к химическим инсектицидам [61]. ]. Исследования Rickettsia других беспозвоночных выявили различное влияние бактерий на их хозяев. Например, у гороховой тли Acyrthosiphon pisum , Rickettsia- инфицированные особи показали более низкую свежую массу тела, пониженную плодовитость и значительно подавленную плотность Buchnera, , что предполагает отрицательный эффект Rickettsia [62], [63] .Репродуктивная манипуляция и партеногенез, ассоциированный с Rickettsia , были показаны у эндопаразитоида Neochrysocharis formosa [64] и у паразитоидной осы Pnigalio soemius [65], как и у Rickettsia beilling -k. ], [67] и участие в оогенезе книжных тупиц [68]. Хотя ни один из более поздних явлений, связанных с Rickettsia , не исследовался в этом исследовании, будет интересно изучить такие взаимодействия Rickettsia с популяциями белокрылки в Бразилии.

Материалы и методы

Коллекция белокрылок

Большинство образцов белокрылки, протестированных в этом исследовании, были собраны в штате Сан-Паулу, а некоторые образцы были собраны в штатах Баия, Минас-Жерайс и Парана на востоке Бразилии в период с 2010 по 2012 год. Для сбора не требовалось никаких специальных разрешений. все образцы в этом исследовании во всех местах, представленных в Таблице 1, и это исследование не касалось исчезающих или охраняемых видов.Взрослых насекомых собирали с помощью ручного аспиратора и сразу же консервировали в 100% этаноле или фиксирующем растворе (см. Ниже) до дальнейшей обработки для генотипирования эндосимбионтов или биотипа или для анализа FISH. В таблице 1 представлены популяции белокрылки, собранные и проанализированные в этом исследовании.

Экстракция ДНК и ПЦР для идентификации биотипов B и Q

ДНК

была выделена из отдельных белокрылок, как описано ранее [28]. От четырех до десяти взрослых особей на популяцию были проанализированы для первоначальной видовой идентификации с использованием пары праймеров Bem23: Bem23F (5′-CGGAGCTTGCGCCTTAGTC-3 ‘) и Bem23R (5′-CGGCTTTATCATAGCTCTCGT-3’) [30], которые различают биотипы на основе B и Q на основе размера фрагмента ПЦР.

Подтверждение видовой идентичности белокрылки для MEAM1, NW2, B. tuberculata и T. acaciae проводили с помощью ПЦР и секвенирования с использованием пары праймеров C1-J-2195 (5′-TTGATTTTTTGGTCATCCAGAAGT-3 ‘) и L2-N- 3014 (5’-TCCAATGCACTAATCTGCCATATTA-3 ‘), которые амплифицируют фрагмент из гена митохондриальной цитохромоксидазы I (mtCOI) [31]. Для T. vaporariorum использовали пару праймеров Tvap-F (5′-GGCATTATTTCTCATCTTATTAGTGCT-3 ‘) и Tvap-R (5′-GTGAYTAAGRGMTGGYTTATT-3’), которые амплифицируют mtCOI этого вида [32].Полученные последовательности были проверены с помощью инструмента BLAST в NCBI. Полученные последовательности от различных видов белокрылки были депонированы в GenBank и им были присвоены номера доступа KM368235, KM368236, KM368246 – KM368249 и KM368251 – KM368255.

Бактериальный эндосимбионт

Одна и та же ДНК, полученная от каждого человека, была использована для скрининга всех шести вторичных эндосимбионтов Hamiltonella , Rickettsia , Wolbachia , Arsenophonus , Cardinium и Fritschea-, специфичных для праймеров. нацелены на гены 16 S или 23 S рДНК.Цикл ПЦР выполняли, как описано ранее [27], [28]. Подтверждение присутствия эндосимбионта выполняли секвенированием амплифицированных последовательностей репрезентативных индивидуумов. Полученные последовательности симионтов различных видов белокрылки были депонированы в GenBank и им были присвоены номера доступа KM368237 – KM368245 и KM368250.

Локализация эндосимбионтов с помощью флуоресцентной гибридизации in situ (FISH)

Для локализации эндосимбионтов у взрослых белокрылок использовали FISH-анализ.Обычно методы, используемые в этом протоколе, были описаны ранее [27], [28], [33]. После сбора образцов насекомых, указанных в таблице 1, их немедленно переносили в фиксатор Карнуа (хлороформ: этанол: уксусная кислота = 6∶3∶1) для фиксации в течение ночи. Затем образцы отбеливали 6% H 2 O 2 в этаноле в течение 2 часов и гибридизовали в течение ночи в буфере для гибридизации (20 мМ трис-HCl [pH 8,0], 0,9 М NaCl, 0,01% SDS, 30% формамид). содержащие 10 пмоль / мл флуоресцентных зондов, специфически нацеленных на различных симбионтов, как подробно описано в таблице 3.Затем образцы были закреплены целиком и просмотрены под конфокальным микроскопом Olympus IX81 Fluoview 500 (Olympus, Токио, Япония). Для каждого эндосимбионта на каждой стадии развития было проанализировано не менее двадцати особей.

Благодарности

Мы хотим поблагодарить сотрудников отдела энтомологии Института защиты растений Центра вулканов за их полезные советы на протяжении всей этой работы.

Вклад авторов

Задумал и спроектировал эксперименты: JMM MG RKS.Проведены эксперименты: JMM AK. Проанализированы данные: JMM MG AK. Предоставленные реагенты / материалы / инструменты анализа: JMM MG RKS MAP. Участвовал в написании рукописи: MG JMM RKS MAP VAY JAMR.

Ссылки

  1. 1.
    Де Барро П.Дж., Лю С.С., Бойкин Л.М., Динсдейл А.Б. (2011) Bemisia tabaci : заявление о статусе вида. Энн Преподобный Энтомол 56: 1–19.
  2. 2.
    Jones CM, Gorman K, Denholm I, Williamson MS (2008) Высокопроизводительная аллельная дискриминация B и Q биотипов белокрылки, Bemisia tabaci , с использованием селективной ПЦР Taq Man.Pest Manag Sci 64: 12–15.
  3. 3.
    Navas-Castillo J, Fiallo-Olivé, E .; Sánchez-Campos S (2011) Новые вирусные болезни, передаваемые белокрылками. Энн Рев Фитопатол 49: 219–248.
  4. 4.
    Ueda S, Brown JK (2006) Первый отчет о биотипе Q Bemisia tabaci в Японии с помощью анализа последовательности митохондриальной цитохромоксидазы I. Phytoparasitica 34: 405–411.
  5. 5.
    Динсдейл А., Кук Л., Ригинос С., Бакли Ю. М., Барро П. (2010) Уточненный глобальный анализ Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae) митохондриальная цитохромоксидаза I для определения генетических границ видового уровня.Энн Энтомол Soc Am 103: 197–208.
  6. 6.
    Алемандри В., Де Барро П., Бехерман Н., Аргуэлло-Каро Э.Б., Дюмон А.Д. и др. (2012) Виды в составе комплекса Bemisia tabaci (Hemiptera: Aleyrodidae) на посевах сои и бобовых в Аргентине. J Econ Entomol 105: 48–53.
  7. 7.
    Фирдаус С., Восман Б., Хидаяти Н., Супена Е., Виссер Р. и др. (2013) Комплекс видов Bemisia tabaci : Дополнения из разных частей мира. Insect Sci. 20: 723–33.
  8. 8.
    Марубаяси Дж. М., Юки В. А., Роча К.Г., Митути Т., Пелегринотти Ф.М. и др. (2013) По крайней мере, два местных вида комплекса Bemisia tabaci присутствуют в Бразилии. J Appl Entomol 137: 113–121.
  9. 9.
    Марубаяси Дж. М., Пелегринотти Ф. М., Феррейра Ф. З., Юки В. А., Митути Т. и др. (2010) Bemisia tuberculata , идентификация на маниоке ( Manihot esculenta ) с помощью анализа митокондриального гена (цитохромоксидаза, mtCOI).Revista Raízes e Amidos Tropicais 6: 92–98 Доступно: http://www.cerat.unesp.br/Home/RevistaRAT/volume6/artigos/artigo17.
  10. 10.
    Rabello AR, Queiroz PR, Simões KCC, Hiragi CO, Lima LHC и др. (2008) Анализ разнообразия биотипов Bemisia tabaci : RAPD, PCR-RFLP и секвенирование области ITS1 рДНК. Genet Mol Biol 31: 585–590.
  11. 11.
    Алонсо Р.С., Ракка-Филхо Ф., Лима А.Ф. (2012) Встречаемость белокрылки (Hemiptera: Aleyrodidae) на культурах маниоки ( Manihot esculenta Crantz) в полевых условиях в штате Рио-де-Жанейро, Бразилия.EntomoBrasilis 5: 78–79 Доступно: http://www.periodico.ebras.bio.br/ojs/index.php/ebras/article/view/170.
  12. 12.
    Lourenção AL, Alves AC, Fugi CGQ, Matos ES (2008) Вспышки Trialeurodes vaporariorum (Запад) (Hemiptera: Aleyrodidae) в полевых условиях в штате Сан-Паулу, Бразилия. Неотроп Энтомол 37: 89–91.
  13. 13.
    Готтлиб Ю., Ганим М., Геген Г., Концедалов С., Вавр Ф. и др. (2008) Унаследованная внутриклеточная экосистема: симбиотические бактерии разделяют бактериоциты белокрылки.FASEB J 22: 2591–2599.
  14. 14.
    Thao ML, Baumann P (2004) Эволюционные отношения первичных прокариотических эндосимбионтов белокрылки и их хозяев. Appl Environ Microbiol 70: 401–3406.
  15. 15.
    Sloan DB, Moran NA (2012) Эндосимбиотические бактерии как источник каротиноидов у белокрылки. Biol Lett 8: 986–9.
  16. 16.
    Thao MLL, Baumann P (2004) Доказательства множественного приобретения Arsenophonus видами белокрылки (Sternorrhyncha: Aleyrodidae).Curr Microbiol 48: 140–144.
  17. 17.
    Moran NA, Degnan PH, Santos SR, Dunbar HE, Ochman H (2005) Игроки в мутуалистическом симбиозе: насекомые, бактерии, вирусы и гены вирулентности. Proc Natl Acad Sci USA 102: 16919–16926.
  18. 18.
    Everett KDE, Thao ML, Horn M, Dyszynski GE, Baumann P (2005) Новые хламидии белокрылки и щитовки: эндосимбионты « Candidatus Fritschea bemisiae », штамм Falk и « Candidatus Fritschea 9000 erioc».Int J Syst Evol Microbiol 55: 1581–1587.
  19. 19.
    Weeks AR, Velten R, Stouthamer R (2003) Заболеваемость новой эндосимбиотической бактерией, искажающей соотношение полов, среди членистоногих. Proc R Soc Lond B Biol Sci 270: 1857–1865.
  20. 20.
    Готтлиб Й., Ганим М., Чил Э., Герлинг Д., Портной В. и др. (2006) Идентификация и локализация Rickettsia sp в Bemisia tabaci (Homoptera: Aleyrodidae). Appl Environ Microbiol 72: 3646–3652.
  21. 21.
    Zchori-Fein E, Brown JK (2002) Разнообразие прокариот, связанных с Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae).Ann Entomol Soc Am 95: 711–718.
  22. 22.
    Ниргианаки А., Бэнкс Г.К., Фролих Д.Р., Венети З., Брейг Х.Р. и др. (2003) Инфекции белокрылки Wolbachia Bemisia tabaci . Curr Microbiol 47: 93–101.
  23. 23.
    Bing XL, Yang J, Zchori-Fen E, Wang XW, Liu SS (2013) Характеристика недавно открытого симбионта белокрылки Bemisia tabaci (Hemiptera Aleyrodidae). Appl Environ Microbiol 72: 569–575.
  24. 24.
    Чил Э., Готтлиб Й., Зхори-Фейн Э., Мозес-Даубе Н, Кацир Н и др.(2007) Биотип-зависимые вторичные сообщества симбионтов в симпатрических популяциях Bemisia tabaci . Bull Entomol Res 97: 407–413.
  25. 25.
    Thao ML, Baumann L, Hess JM, Falk BW, Ng JC и др. (2003) Филогенетические данные о двух новых связанных с насекомыми хламидиях семейства Simkaniaceae. Curr Microbiol 47: 46–50.
  26. 26.
    Чу Д., Гао Ц., Де Барро П.Дж., Чжан Й., Ван Ф. и др. (2011) Дальнейшее понимание странной роли бактериальных эндосимбионтов у белокрылки, Bemisia tabaci : Сравнение вторичных симбионтов из биотипов B и Q в Китае.Bull Entomol Res 101: 477–486.
  27. 27.
    Скаляц М., Занич К., Бан С.Г., Концедалов С., Ганим М. (2010) Совместная инфекция и локализация вторичных симбионтов у двух видов белокрылки. BMC Microbiology 10: 142
  28. 28.
    Скаляц М., Занич К., Хрнчич С., Радонич С., Перович Т. и др. (2013) Разнообразие и локализация бактериальных симбионтов у трех видов белокрылок (Hemiptera: Aleyrodidae) восточного побережья Адриатического моря. Bull Entomol Res 103: 48–59.
  29. 29.Gueguen G, Vavre F, Gnankine O, Peterschmit M, Charif D, et al. (2010) Метасообщества эндосимбионтов, разнообразие мтДНК и эволюция комплекса видов Bemisia tabaci (Hemiptera: Aleyrodidae). Мол Экол 19: 4365–4376.
  30. 30.
    Де Барро П.Дж., Скотт К.Д., Грэм Г.К., Ланге К.Л., Шутце М.К. (2003) Выделение и характеристика микросателлитных локусов в Bemisia tabaci . Мол Экол Примечания 3: 40–43.
  31. 31.
    Frohlich D, Torres-Jerez I, Bedford ID, Markham PG, Brown JK (1999) Филогеографический анализ комплекса видов Bemisia tabaci на основе маркеров митохондриальной ДНК.Мол Экол 8: 1593–1602.
  32. 32.
    Скотт IAW, Workman PJ, Drayton GM, Burnip GM (2007) Первая запись Bemisa Tabaci биотипа Q в Новой Зеландии. N Z Plant Protect 60: 264–270.
  33. 33.
    Готтлиб Ю., Ганим М., Геген Г., Концедалов С., Вавр Ф. и др. (2008) Унаследованная внутриклеточная экосистема: симбиотические бактерии разделяют бактериоциты белокрылки. FASEB J 22: 2591–2599.
  34. 34.
    Mitsuhashi W, Saiki T, Wei W, Kawakita H, Sato M (2002) Два новых штамма Wolbachia , сосуществующие в обоих видах тутовых цикад.Насекомое Mol Biol 11: 577–584.
  35. 35.
    Sintupachee S, Milne JR, Poonchaisri S, Baimai V, Kittayapong P (2006) Тесно связанные штаммы Wolbachia в сообществе тыквенных членистоногих и потенциал горизонтальной передачи через растение. Microb Ecol 51: 294–301.
  36. 36.
    Грей С.М., Банерджи Н. (1999) Механизмы передачи вирусов растений и животных членистоногими. Microbiol Mol Biol Rev 63: 128–148.
  37. 37.
    Zchori-Fein E, Gottlieb Y, Kelly SE, Brown JK, Wilson JM, et al.(2001) Недавно открытая бактерия, связанная с партеногенезом и изменением поведения при выборе хозяина у паразитоидных ос. Proc Natl Acad Sci USA 98: 12555–12560.
  38. 38.
    Бильярди Э., Сакки Л., Генчи М., Алма А., Паджоро М. и др. (2006) Ультраструктура нового Cardinium sp. симбионт в Scaphoideus titanus (Hemiptera: Cicadellidae). Тканевая клетка 38: 257–261.
  39. 39.
    Каспи-Флюгер А., Инбар М., Мозес-Даубе Н., Кацир Н., Портной В. и др.(2012) Горизонтальная передача симбионта насекомых Rickettsia опосредована растениями. Proc R Soc Lond B Biol Sci 279: 1791–1796.
  40. 40.
    Вотрен Э., Вавр Ф. (2009) Взаимодействия между вертикально передающимися симбионтами: сотрудничество или конфликт? Тенденции Microbiol 17: 95–99.
  41. 41.
    Вотрен Э., Дженис С., Шарль С., Вавр Ф. (2008) Сосуществуют ли вертикально передающиеся симбионты в одном хозяине, конкурируют или сотрудничают? Модельный подход. Журнал Evol Biol 21: 145–161.
  42. 42.
    Chen DQ, Montllor CB, Purcell AH (2000) Фитнес-эффекты двух факультативных эндосимбиотических бактерий на гороховую тлю, Acyrthosiphon pisum , и голубую люцерновую тлю, A. kondoi . Entomol Exp Appl 95: 315–323.
  43. 43.
    Darby AC, Birkle LM, Turner SL, Douglas AE (2001) Бактерия, переносимая тлями, родственная вторичным симбионтам белокрылки. FEMS Microb Ecol 36: 43–50.
  44. 44.
    Darby AC, Tosh CR, Walters KFA, Douglas AE (2003) Значение факультативной бактерии для природных популяций гороховой тли Acyrthosiphon pisum .Ecol Entomol 28: 145–150.
  45. 45.
    Цучида Т., Кога Р., Шибао Х., Мацумото Т., Фукацу Т. (2002) Разнообразие и географическое распространение вторичных эндосимбиотических бактерий в природных популяциях гороховой тли, Acyrthosiphon pisum . Мол Экол 11: 2123–2135.
  46. 46.
    Haynes S, Darby AC, Daniell TJ, Webster G, Van Veen FJF и др. (2003) Разнообразие бактерий, связанных с естественными популяциями тлей. Appl Environ Microbiol 69: 7216–7223.
  47. 47.Ferrari J, Darby AC, Daniell TJ, Godfray HCJ, Douglas AE (2004) Связь бактериального сообщества гороховой тли с использованием растений-хозяев и естественной сопротивляемостью врагов. Ecol Entomol 29: 60–65.
  48. 48.
    Чил Э., Зхори-Фейн Э., Инбар М., Готтлиб Ю., Адачи-Хагимори Т. и др. (2009) Почти там: пути передачи бактериальных симбионтов между трофическими уровнями. PLoS ONE 4: e4767.
  49. 49.
    Heath BD, Butcher RDJ, Whitefield WGF, Hubbard SF (1999) Горизонтальный перенос Wolbachia между филогенетически удаленными видами насекомых по естественному механизму.Curr Biol 9: 313–316.
  50. 50.
    Балас М.Т., Ли М.Х., Веррен Дж. Х. (1996) Эффекты распространения и приспособляемости бактерии sonkiller в nasonia. Evol Ecol 10: 593–607.
  51. 51.
    Stouthamer R, Breeuwer JAJ, Hurst GDD (1999) Wolbachia pipientis : Микробный манипулятор воспроизводства членистоногих. Annu Rev Microbiol 53: 71–102.
  52. 52.
    Lawson ET, Mousseau TA, Klaper R, Hunter MD, Werren JH (2001) Rickettsia , связанный с убийством самцов у жука-бупрестида.Наследственность 86: 497–505.
  53. 53.
    Hunter MS, Perlman SJ, Kelly SE (2003) Бактериальный симбионт у Bacteroidetes вызывает цитоплазматическую несовместимость у паразитоидной осы Encarsia pergandiella . Proc R Soc Lond B Biol Sci 270: 2185–2190.
  54. 54.
    Wernegreen JJ (2004) Эндосимбиоз: уроки разрешения конфликтов. PLoS Biol 2: 307–311.
  55. 55.
    Bouchery T, Lefoulon E, Karadjian G, Nieguitsila A, Martin C (2013) Симбиотическая роль Wolbachia в Onchocercidae и ее влияние на филяриатоз.Clin Microbiol Infect 19: 131–40.
  56. 56.
    Риччи И., Дамиани С., Капоне А., ДеФриче С., Росси П. и др. (2012) Взаимодействие комаров и микробиоты: от сложных взаимоотношений к биотехнологическим перспективам. Curr Opin Microbiol 15: 278–84.
  57. 57.
    Брумим М., Леви М., Ганим М. (2012) Трансовариальная передача Rickettsia spp. и органоспецифическая инфекция белокрылки Bemisia tabaci. . Appl Environ Microbiol 78: 5565–5574.
  58. 58.Perotti MA, Clarke HK, Turner BD, Braig HR (2006) Rickettsia как облигатные и мицетомные бактерии. FASEB J 20: 1646–1656.
  59. 59.
    Гимлер А.Г., Адачи-Хагимори Т., Берген Дж. Э., Козуч А., Келли С. Е. и др. (2011) Быстрое распространение бактериального симбионта у инвазивной белокрылки обусловлено преимуществами фитнеса и предвзятостью самок. Наука 332: 254–256.
  60. 60.
    Брумин М., Концедалов С., Ганим М. (2011) Rickettsia влияет на термотолерантность биотипа белокрылки Bemisia tabaci B.Наука о насекомых 18: 57–66.
  61. 61.
    Концедалов С., Жори-Фейн Э., Чиль Э., Готлиб Ю., Инбар М. и др. (2008) Присутствие Rickettsia связано с повышенной восприимчивостью Bemisia tabaci (Homoptera: Aleyrodidae) к инсектицидам. Pest Manag Sci 64: 789–792.
  62. 62.
    Chen DQ, Montllor CB, Purcell AH (2000) Фитнес-эффекты двух факультативных эндосимбиотических бактерий на гороховую тлю, Acyrthosiphon pisum и голубую люцерновую тлю, A.кондой . Entomol Exp Appl 95: 315–323.
  63. 63.
    Sakurai M, Koga R, Tsuchida T, Meng XY, Fukatsu T (2005) Rickettsia , симбионт гороховой тли Acyrthosiphon pisum : новый клеточный тропизм, влияние на приспособленность хозяина и взаимодействие с основным симбионтом
    Buchnera
    . Appl Environ Microbiol 71: 4069–4075.
  64. 64.
    Hagimori T, Abe Y, Date S, Miura K (2006) Первая находка бактерии Rickettsia , связанной с индукцией партеногенеза среди насекомых.Curr Microbiol 52: 97–101.
  65. 65.
    Giorgini M, Bernardo U, Monti MM, Nappo AG, Gebiola M (2010) Симбионты Rickettsia вызывают партеногенетическое размножение у паразитоидной осы Pnigalio soemius (Hymenoptera: Eulophidae). Appl Environ Microbiol 76: 2589–2599.
  66. 66.
    Werren JH, Hurst GDD, Zhang W., Breeuwer JAJ, Stouthamer R и др. (1994) Риккетсиозный родственник, связанный с убийством самцов жука-божьей коровки ( Adalia bipunctata ).J Bacteriol 176: 388–394.
  67. 67.
    фон дер Шуленбург JHG, Habig M, Sloggett JJ, Webberley KM, Bertrand D, et al. (2001) Частота гибели самцов Rickettsia spp. (α-протеобактерии) у десятипочечного жука-божьих коровок Adalia decempunctata L. (Coleoptera: Coccinellidae). Appl Environ Microbiol. 67: 270–277.
  68. 68.
    Юсуф М., Тернер Б. (2004) Характеристика Wolbachia -подобных бактерий, выделенных из партеногенетического вредителя хранимого продукта psocid Liposcelis bostrychophila (Badonnel) (Psocoptera).J Stored Prod Res 40: 207–225.
  69. 69.
    Muyzer G, Hottentrager S, Teske A, Wawer C (1996) Денатурирующий градиентный гель-электрофорез PCR-амплифицированной 16s рДНК — новый молекулярный подход к анализу генетического разнообразия смешанных микробных сообществ. В Akkermans ADL, van Elsas JD, Bruijn FJ, редакторы. Руководство по молекулярной микробной экологии 3.4.4. Дордрехт, Нидерланды. Kluwer Academic Publishers. 1–23.
  70. 70.
    Heddi A, Grenier AM, Khatchadourian C, Charles H, Nardon P (1999) Четыре внутриклеточных генома прямой биологии долгоносиков: ядерный, митохондриальный, основной эндосимбионт и Wolbachia.Proc Natl Acad Sci USA 96: 6814–6819.
  71. 71.
    Маталон Ю., Кацир Н., Готтлиб Ю., Портной В., Жори-Фейн Е. (2007) Кардиний в Plagiomerus diaspidis (Hymenoptera: Encyrtidae). Дж. Инвертировать Патол 96: 106–108.

Биохимические доказательства соединений эпикутикулярного воска, участвующих во взаимодействии хлопка и белокрылки

Abstract

Сосущим насекомым требуется поверхность растений, на которой будут прилипать ноги и яйца насекомых и к которой будут иметь доступ ротовые органы насекомых.Основная защита растений от насекомых — это свойство их поверхности, которая препятствует прикреплению лапок и яиц насекомых. Химический состав эпикутикулярных восков влияет на тонкую структуру кутикулярной поверхности. В текущем исследовании была предпринята попытка изучить изменение химических соединений в эпикутикулярных восках четырех видов хлопчатника, которые классифицируют их как устойчивые или чувствительные, то есть Gossypium abroreum , G . hirsutum , G . arboreum мутант с дефицитом воска (GaWM3) и G . harknessi , которые оценивали на их взаимодействие с белокрылкой и передачей CLCuV. Gossypium hirsutum , насекомое и сорт хлопчатника, чувствительный к CLCuV, содержит четыре соединения, а именно трихлоруксусную кислоту, гексадецилэфир, P-ксиленолфталеин, 2-циклопентен-1-ол, 1-фенил и фенол, 2,5-бис [1 , 1-диметил], который мог взаимодействовать с хитином белокрылки, в то время как только два соединения в Gossypium arboreum насекомое и устойчивый к CLCuV сорт хлопчатника могли взаимодействовать с хитином белокрылки.Аналогичным образом было обнаружено, что GaWM3 и Gossypium harkasnessi содержат только одно соединение. Количество белокрылок на листьях G . hirsutum был намного выше по сравнению с другими видами хлопчатника. Принимая во внимание этот факт, воск биосинтетического гена CER3 из Arabidopsis thaliana был преобразован в G . hirsutum , и растения оценивали на их устойчивость к белокрылке и передаче CLCuV. При микроскопическом анализе трансгенные растения ясно показали более высокое количество восков на листьях по сравнению с нетрансгенными растениями.Наименьшая популяция белокрылки и титр CLCuV <10 000 единиц был обнаружен у трансгенных растений по сравнению с нетрансгенным хлопком, где он составлял ≈4,5 × 106 единиц, что подтвердило роль воска во взаимодействии с насекомыми и, в конечном итоге, в передаче CLCuV. Это исследование дает новое представление о соединениях, связанных с воском, участвующих во взаимодействии хлопка и белокрылки, что потенциально может помочь в разработке более эффективных стратегий борьбы с этим разрушительным вредителем.

Образец цитирования: Али М.А., Хан МАУ, Рао А.К., Икбал А., Дин Су, Шахид А.А. (2021) Биохимические доказательства соединений эпикутикулярного воска, участвующих во взаимодействии хлопка и белокрылки.PLoS ONE 16 (5):
e0250902.

https://doi.org/10.1371/journal.pone.0250902

Редактор: Аллах Бахш, Университет Нигде Омер Халисдемир, ТУРЦИЯ

Поступила: 9 февраля 2021 г .; Принят в печать: 15 апреля 2021 г .; Опубликован: 4 мая 2021 г.

Авторские права: © 2021 Ali et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

Финансирование: Авторы не получали специального финансирования на эту работу.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Первой зоной, в которой приближающиеся насекомые соприкасаются с растением, является поверхность кутикулы растения. Физические и химические характеристики эпикутикулярных восков могут препятствовать передвижению насекомого и препятствовать доступу насекомых к различным частям растения.Кутикулярные соединения растений ответственны за инициирование поведения отторжения, так как, например, сообщалось, что оседание тли на растения предотвращается 1-гексакозанолом и короткоцепочечными жирными кислотами, а также карбоновыми кислотами и сложными эфирами воска, которые обладают антиксенотическими свойствами (C3 – C13), таким образом препятствовать кормлению насекомых [1]. Уменьшение укусов насекомых вместе с увеличением времени ходьбы гусениц и чешуекрылых было обнаружено на листьях крестоцветных хозяев, имеющих длинноцепочечные спирты и амирины в глянцевых восковых линиях размножения [2].Восковые соединения на поверхности растений, включая длинноцепочечные алканы, спирты, карбоновые кислоты, а также вторичные метаболиты, такие как хиноны и флавоноиды, играют свою роль в стимуляции питания насекомых [3]. Были использованы различные подходы к исследованию роли эпикутикулярных восков растений на поведение насекомых. Тестирование восковых мутантов вместе с генотипом видов растений, имеющих различный восковой состав и химический состав, используются для определения влияния характеристик поверхности растений на насекомых, а прикрепление грибов широко используется и все еще требует проведения в больших масштабах [4].Воски из листьев были исследованы с использованием отварного метода экстракции воска, при котором листья растений на короткое время погружают в органический растворитель, затем этот органический растворитель выпаривают для концентрирования воска [5]. Для этого эксперимента использовался метод экстракции хлороформ-метанол для экстракции парафина, как описано в [6]. Современные методы биохимии, такие как газовая хроматография-масс-спектрометрия, используются для исследования состава экстрагированных восков [7].

Эпикутикулярный воск в хлопке бывает разных типов, и сообщалось о вариациях от вида к виду с точки зрения количества и состава [8].Среди этих азиатских хлопчатников или Gossypium arboreum хорошо документировано, что они устойчивы к CLCuD, ни один из видов Gossypium hirsutum не был зарегистрирован как устойчивый к CLCuD [9]. Барозай и Хуснайн (2014) сообщили о более высоком количестве парафина в G . arboreum , чем G . hirsutum [10, 11]. Аналогичным образом, отрицательная корреляция между CLCuV и количеством эпикутикулярного воска была обнаружена в исследовании различных сортов хлопчатника, тогда как положительная корреляция между популяцией белокрылки и CLCuV [10].Виды хлопка могут быть диплоидными или тетраполоидными, состоящими из генома A или D, что делает их физические свойства отличными друг от друга [12]. Хотя основная роль эпикутикулярных восков заключается в обеспечении защиты от абиотических стрессов, они также играют важную роль в прикреплении насекомых к растениям через лапки насекомых [13]. Eigenbrode и Espelie, 1995 показали усиление прикрепления насекомых при уменьшении количества эпикутикулярных восков в растениях [13]. Иногда кристаллы воска увеличивают поддержку прикрепления насекомых, обеспечивая силу сцепления с лапками насекомых [13].В некоторых случаях кристаллы воска сливаются, когда насекомое пытается прикрепиться, и, следовательно, поверхность становится скользкой для насекомых [14]. Некоторые исследования показали, что определенные соединения участвуют в управлении поведением насекомых в направлении взаимодействия с растениями, например глюкозинолаты, вторичные метаболиты, которые влияют на взаимодействия насекомых-растений в семействе Brassicaceae [15]. Таким образом, существует перекрестная связь между насекомыми и различными типами, количеством и компонентами воска на поверхности листа эпикутикулы.

CER3 — ключевой ген биосинтеза парафина, который принадлежит к семейству Eceriferum и высоко экспрессируется во время развития кутикулы Arabidopsis [16].CER3 играет важную роль в важном пути образования алканов в синтезе основных восковых компонентов [17]. Сообщалось, что CER3 и некоторые другие родственные воску мутантные штаммы Arabidopsis thaliana обнаруживают серьезные дефекты в восках эпикутикулы и биосинтез кутина и демонстрируют значительно более низкий уровень различных составляющих парафина [18]. CER3 и CER1 идентифицированы как основной компонент комплекса синтеза очень длинноцепочечных алканов, когда биосинтез алканов был реконструирован в дрожжах и Arabidopsis [19].Обнаружено, что длинноцепочечные жирные кислоты и первичные спирты являются основными составляющими эпикутикулярных восков [20]. Несколько генов, родственных воску, были клонированы и охарактеризованы, но четыре из этих CER2, CER3, GL2 и GL15 кодируют регуляторные локусы [21].

Основной целью настоящего исследования было определение качественной роли восковых соединений в прикреплении белокрылки и ее способности передавать CLCuV. Среди разных видов хлопка G . hirsutum наиболее восприимчив к CLCuV [22]. Г . hirsutum — это наиболее широко выращиваемый вид хлопка, на который приходится более 90% выращиваемого во всем мире хлопка, и это самая важная волокнистая культура в мире [23]. Принимая во внимание тот факт, что ген биосинтеза парафина планировалось экспрессировать в G . hirsutum за характеристику количества воска для определения его роли в привлечении насекомых, а также использование четырех различных видов хлопка с различным содержанием воска для определения посещения насекомыми и передачи вируса.

Материал и методы

Виды хлопка Gossypium abroreum , G . hirsutum , G . arboreum мутант с дефицитом воска (GaWM3) и G . harknessi были подвергнуты выделению парафиновых соединений, следуя описанному ниже методу.

Изоляция эпикутикулярного воска

Площадь поверхности хлопкового листа рассчитывалась с использованием метода ImageJ [24] Easy Leaf Area Method. Для выделения воска отбирали 500 мг листьев хлопка с шестинедельных растений четырех генотипов хлопка и сразу же погружали в хлороформ на 20 секунд при комнатной температуре.Всего 20 мкг тетракозана (C24) использовали в качестве внутреннего стандарта в 20 мл экстракта кутикулярного воска. Растворитель выпаривали до тех пор, пока не осталось 1 мл, и переносили в новую пробирку на 2 мл. При сушке образца для метилирования свободных кислот добавляли всего 10 капель диазометана. Добавляли всего по 100 мкл пиридина и уксусного ангидрида каждого, и образцы выдерживали при 60 ° C в течение 1 часа. Растворитель снова выпаривали и экстракт растворяли в 500 мкл смеси гептан: толуол (1: 1 об. / Об.) С последующей промывкой раствора 400 мкл 1% NaHCO3.

Сравнение биохимического состава парафина опытных растений

Для газового хроматографо-масс-спектрометрического анализа в образец добавляли тетракозан (10 мкг / мл) в качестве внутреннего контроля. Количественное определение отдельных соединений проводили по внутреннему стандарту путем ручного интегрирования площадей пиков [25].

Биохимический анализ эпикутикулярного воска трех генотипов хлопчатника вместе с восковым мутантом G . arboreum сильно различается по составу соединений.Хотя эти растения принадлежат к одному роду, виды демонстрируют разный уровень устойчивости к заражению белокрылкой. Некоторые соединения уникальны для определенного генотипа, но многие соединения являются общими для всех генотипов. Сравнение этих химических соединений показано в таблице S1 (дополнительные данные). Хитин белокрылки является первой точкой контакта с эпикутикулярными восками хлопчатника [26], а структура хитина была взята из [27].

Опосредованная Agrobacterium генетическая трансформация Gossypium hirsutum

Семена одобренного местного хлопка ( Gossypium hirsutum ) сорта CEMB-66 были взяты из исследовательского хранилища Центра передового опыта в области молекулярной биологии Университета Пенджаба, Лахор, Пакистан, для экспериментов по трансформации из-за его чувствительности к CLCuV и более высокой всхожести. темп.Оптимизированный по кодонам ген CER3 лигировали в pCAMBIA1302 под промотором CaMV35S. Семена хлопчатника трансформировали с помощью метода трансформации верхушки побега, опосредованного Agrobacterium, как сообщалось ранее [28]. Предполагаемые трансгенные растения хлопка, которые выживали на средах, содержащих различные гормоны [29] и селективный препарат канамицин (50 мкг / мл), акклиматизировали в горшках и подвергали молекулярному анализу для подтверждения успешного введения трансгена. Эти предполагаемые трансгенные растения хлопка были перемещены в поле для дальнейшего анализа.

Подтверждение наличия трансгена в предполагаемых трансгенных растениях хлопчатника

Свежие проросшие листья предполагаемых трансгенных и контрольных растений хлопка были взяты и подвергнуты экстракции ДНК по протоколу экстракции CTAB [30]. Полимеразную цепную реакцию (ПЦР) проводили для подтверждения введения трансгена с использованием ген-специфичного прямого праймера 5 ’CACTTAGGATCTCTAGTCCAC 3’ и обратного праймера 5 ’GTTAGACTCATCCTTACCTCTCTC 3’ для амплификации фрагмента длиной 452 п.н. Условия ПЦР были установлены как начальная денатурация при 95 ° C в течение 5 минут с последующими 35 циклами при 95 ° C в течение 30 секунд, отжиг при 60 ° C в течение 40 секунд, удлинение при 72 ° C в течение 45 секунд.Окончательное удлинение было установлено при 72 ° C в течение 10 минут.

Измерение титра вируса (β-сателлит) с помощью количественной ПЦР в реальном времени

Абсолютное количественное определение β-сателлитных компонентов CLCuV в трансгенных и контрольных растениях хлопчатника было выполнено с помощью ПЦР в реальном времени, стандарты были приготовлены путем серийного разведения после получения очищенной плазмиды с концентрацией 2,5 × 10 8 молекул / мкл, от Plant лаборатория трансформации CEMB, PU, ​​Лахор, Пакистан. Всего было приготовлено четыре серийных разведения для стандартной кривой в соотношении 1:10, 1: 100, 1: 1000 и 1: 10 000.Праймеры F; 5 ’TTCCTATTCGCATACAACGG 3’ и R; 5 ’ATGCATT GCTGGTTGTGTT 3’ использовали для абсолютного количественного определения титров β-сателлитов в образцах листьев, следуя процедуре, описанной ранее [31]. ДНК, выделенную из трансгенных и контрольных линий хлопка, использовали в качестве матрицы, и образец данных обрабатывали в трех повторностях. GAPDH использовался в качестве внутреннего контроля и пять стандартов A1, A2, A3, A4 и A5 номиналом 2,5×10 8 , 2,5×10 7 , 2,5×10 6 , 2,5×10 5 и 2.5×10 4 соответственно, были использованы для построения стандартной кривой. Условия реакции для β-сателлитов были следующие: начальная денатурация при 95 ° C в течение 5 минут, затем 40 циклов денатурации при 95 ° C в течение 30 секунд, отжиг при 58 ° C в течение 30 секунд и удлинение при 72 ° C в течение 30 секунд. 30 секунд и заключительный этап удлинения при 72 ° C в течение 10 минут.

Определение взаимодействия растений с насекомыми (хлопчатник и белокрылка)

Белокрылкам разрешено питаться экспериментальными растениями хлопчатника в течение всего сезона.Данные собирались случайным образом в течение семи недель подряд, и среднее количество белокрылок, которые посетили G . hirsutum , G . harknessii , GaWM3 и G . дендрариев рассчитано за весь сезон. Также наблюдали привлечение белокрылки на трансгенных и контрольных растениях Gossypium hirsutum .

Аналогичным образом, лист был отделен от восприимчивого Gossypium hirsutum и его трансгенной версии, а белокрылки получили возможность питаться ими.Сравнивали количество взрослых белокрылок вместе с нимфой орла и белокрылки у трансгенных и контрольных животных.

Сравнение поперечных срезов трансгенных и контрольных листьев под микроскопом

Листья трансгенного контрольного хлопка ( G . hirsutum ) и G . arboreum (азиатский хлопок с высоким содержанием парафина, устойчивый к CLCuV) вырезали, и срезы от 2 до 3 мм вырезали бритвенным лезвием и фиксировали в параформальдегидном фиксаторе. Образцы заливали расплавленным парафином и оставляли для осаждения при комнатной температуре, после чего проводили микротомию.Срезы тканей 5–10 мкм были разрезаны на микротоме (Microme HM 340-E). Перед тем, как приступить к микроскопии, встроенные срезы сушили при 37 ° C в течение одного часа, а трансгенные и контрольные образцы подвергали депарафинизации для получения более точных изображений. Образцы выдерживали при 56 ° C в течение 10 минут, а затем слайды погружали в ксилол три раза по 5 минут каждое с новым ксилолом для полного удаления воска с кутикулы. Изображения были получены с помощью инвертированного флуоресцентного микроскопа (Olympus1X51) (увеличение 200x).

Результаты

Сравнительное сопоставление идентифицированных восковых соединений хлопчатника

Эти соединения были сопоставлены с использованием программного обеспечения PyMOL версии 2.3 (https://pymol.org/2/), которое выявило различную структуру для каждого генотипа (дополнительный файл).

Определение взаимодействия соединений воска хлопка с хитином белокрылки

Трихлоруксусная кислота, гексадецилэфир.

Трихлоруксусная кислота, гексадециловый эфир были идентифицированы в восковой композиции G . hirsutum . Было обнаружено, что атомы хлора связаны с центральным углеродом, присоединенным к карбонильной группе, таким образом, центральный углерод сильно дефицитен для электронной цепи и проявляет некоторое сродство к хитину [32] (рис. 1A).

Рис. 1.

(A) Взаимодействие трихлоруксусной кислоты, гексадецилэфира с хитином, где центральный углерод, присоединенный к хлору, сильно дефицитен по отношению к электрону и может взаимодействовать с электронной парой из хитина. (B) Взаимодействие P-ксиленолфталеина с хитином за счет образования водородных связей.

https://doi.org/10.1371/journal.pone.0250902.g001

P-ксиленолпталеин.

P-ксиленолфталеин также был одним из идентифицированных соединений в составе парафина G . hirsutum , имеющий сходство по строению с фенолфталеином. Группа ОН фенолфталеина обладает сродством к притяжению электронов. Они могут образовывать водородную связь с атомом кислорода, присутствующим между полимерами или любой другой ОН-группой хитина при посещении насекомых (рис. 1В).

2-циклопентен-1-ол, 1-фенил-.

Это соединение присутствует как в G . hirsutum и G . дендрарий . H в 2-циклопентен-1-оле, 1-фенил- находится над структурой платы, которая взаимодействует с кислородом, присутствующим между полимерами и группами ОН, присутствующими в структуре хитина [33] (рис. 2A).

Рис. 2.

(A) Взаимодействие водорода 2-циклопентен-1-ол-фенил- с кислородом и гидроксильной группой, присутствующей в хитине. (B) Взаимодействие водорода фенола, 2, 5, бис [1,1-диметил] с кислородом и гидроксильной группой, присутствующей в хитине.

https://doi.org/10.1371/journal.pone.0250902.g002

Фенол, 2,5-бис [1,1-диметил].

Это соединение присутствует в G . arboreum , GaWM3 и G . hirsutum . Фенол, 2,5-бис [1,1-диметил] является электронодефицитным по группе ОН, которая может взаимодействовать с «О», присутствующим между полимерами и группами ОН, присутствующими в структуре хитина (рис. 2В).

Пиперидинон, н- | 4-бром-н-бутил |.

Это уникальное соединение было найдено только в воске G . дендрарий . Углерод, присоединенный к Br, является частично положительным и имеет сродство к электронной паре, присутствующей в «O» хитина (рис. 3A).

Ланцет, цис-.

Это соединение было обнаружено в воске G . харкнессии . H, присутствующий в группе OH, является электронодефицитным, он находится над платой и может взаимодействовать с O, присутствующим в хитине [34] (рис. 3B).

Соединения

G . hirsutum , которые вряд ли будут взаимодействовать с хитином

Соединения тетрадекан, 2,6,10-триметил-, 1,2-бензолдикарбоновая кислота, диизооктиловый эфир и нонадекан вряд ли будут взаимодействовать с хитином, однако 2-трифторацетокситерадекан взаимодействует с хитином, но группа имеет углерод с F и маловероятно взаимодействовать с хитином.

Соединения

G . arboreum , которые вряд ли будут взаимодействовать с хитином

Восковые соединения, присутствующие в G . arboreum маловероятно или очень трудно взаимодействовать с хитином из-за структуры или химического состава, т.е. 1,2-бензолдикарбоновая кислота, диизооктиловый эфир, 3-трифторацетокситетрадекан, 6-октадеценовая кислота, метиловый эфир, гептадекановая кислота, 16-метил- , метиловый эфир, 4-гептафторбутироксипентадекан, метоксиуксусная кислота, 2-тридецилэфир, нонадекан, силан, трихлордокозил- и тетрадекан, 2,6,10-триметил.

В силане трихлордокозил-Si содержит 3 Cl, но менее отрицательный, чем углерод.В 4-гептафторбутироксипентадекане углерод, имеющий 7 F, находится ниже доски и имеет электронное облако F. Аналогично, 3-трифторацетокситетрадекан, углерод находится ниже плоскости, поэтому очень маловероятно, что эти соединения вместе с остальными соединениями, упомянутыми выше, будут взаимодействовать с хитином.

Соединения GaWM3, которые вряд ли взаимодействуют с хитином

Соединения GaWM3 P-ксиленолфталеина, трихлоруксусной кислоты, гексадецилэфира, 2-трифторацетокситерадекана, | 5- [3-метоксиметокси-10,13-диметил-2,3,4,9,10,11,13,14,15, 16,17-додекагидро-, 15,17,19,21-гексатриаконтатетраин, октадекан, 1- | 2- [гексадецилокси] этокси | -, AD-глюкопиранозид, метил-2- [ацетиламино] -2-дезокси-3-O — [триметилсиллил] -, циклический метилбронат, этанол, 2- [октадецилокси], 7,9-ди-тет-бутил-1-оксаспиро [4,5] дека– 6,9-диен-2,8-дион, Диэтилфталат, эйкозан, 2-метил-, эйкозан, 2-метил-, гексадекан, α-кариофиллен, кариофиллен, 1,2-бензолдикарбоновая кислота, диизооктиловый эфир, тетрадекан, 2,6,10-триметил-, метоксиуксус и нонадекан являются вряд ли взаимодействует с хитином.

Соединения

G . harknessii , которые вряд ли будут взаимодействовать с хитином

Соединения, обнаруженные в воске G . harknessii 2-нафталинметанол, декагидро- α, α, 4a-триметил-8-метилен-, | 2R- [2 α , 4aα, 8aβ] | -, 2,6,10-додекатриен-1-ол, 3,7,11-трометилацетат, [E, E] — 2,6,10-додекатриен-1-ол, 3,7,11-трометилацетат, [E, E] -, нафталин, 1,2 , 3,4,4a, 5,6,8a-октагидро-7-метил-4-4метилен-1- [1-метилэтил], [1α, 4aβ, 8aα] -, α-кариофиллен вряд ли будут взаимодействовать с хитин.

Трансформация гена CER3 с оптимизацией кодонов в хлопке

Всего 6000 эмбрионов были использованы в агробактериях трансформации верхушки побега хлопка, а отбор трансгенов производился на селективном препарате канамицин (рис. 4A – 4F). После акклиматизации для дальнейшего анализа были отобраны четыре предполагаемых трансгенных растения хлопка с наилучшими характеристиками. Рассчитанная эффективность трансформации составила 0,97% на основании выживаемости растений и 0,1% на основании подтверждения наличия трансгена молекулярным анализом.

Рис. 4.

A: проросшие семена, B: повреждение зародышей острым лезвием на стороне верхушки побега, C: совместное культивирование эмбрионов с агробактериями, D: зародыши в питательной среде, E: растения в среде для укоренения и выстрела, F: Растения в почвенных горшках для акклиматизации.

https://doi.org/10.1371/journal.pone.0250902.g004

Подтверждение предполагаемых трансгенных растений

Введение трансгена в растения хлопка было подтверждено путем амплификации с использованием специфичных для генов праймеров.Фрагмент размером 452 п.н. был амплифицирован в четырех трансгенных растениях хлопчатника, сокращенно обозначенных восковыми линиями (WL-1, WL-2, WL-3, WL-4) и положительным контролем, в то время как в отрицательных (нетрансгенных) случаях амплификации не наблюдалось. контроль хлопчатника (рис. 5).

Количественная ПЦР в реальном времени для титров β-сателлитов

Косвенная цель исследования заключалась в оценке трансгенных растений хлопка на титр CLCuV, поскольку наименьшая популяция белокрылки приведет к снижению количества копий вируса, доставляемых белокрылкой, и позволит растениям справиться с меньшим количеством копий CLCuV.Компоненты CLCuV, β-сателлиты оценивали во всех четырех выбранных трансгенных линиях хлопка, а именно WL1, WL2, WL3 и WL4, по сравнению с нетрансгенными контрольными растениями хлопка. Значительно меньший титр CLCuV, то есть от 7738 до 13775 в хлопчатнике линий WL1 и WL3, по сравнению с нетрансгенным контрольным хлопком и . e 4.5×10 6 наблюдалось (рис. 6). Gossypium hirsutum наиболее восприимчив к CLCuV, но трансгенное растение, имеющее родственный воску трансген, показало значительное улучшение устойчивости к передаче вируса от белокрылки, что подтверждает идею о роли парафина в борьбе с насекомыми и косвенно по отношению к вирусу.

Взаимосвязь между популяцией белокрылки и составом эпикутикулярных восков

Среднее количество белокрылки рассчитано по G . hirsutum было 40 по сравнению с 29 из G . harknessii , 31 GaWM3 и 27 G . дендрарий . Г . hirsutum наиболее восприимчив к CLCuV и является привлекательным видом хлопчатника для белокрылки. Этот эксперимент подтверждает данные о том, что изменение состава соединений парафина играет важную роль в определении привлекательности белокрылки для посещения завода.В одном аспекте уменьшение количества парафина и изменение состава в одном из мутантов GaWM3 G . arboreum устойчивый к CLCuV сорт хлопчатника привел к повышенной тенденции посещения белокрылками (рис. 7A). Также был проведен анализ питания трансгенных и контрольных растений хлопка и трансгенных растений G . hirsutum оказался менее привлекательным для белокрылки по сравнению с нетрансгенными контрольными растениями хлопка, что дополнительно подтверждает идею о роли воска в изменении поведения насекомых при их посещении хлопчатника (рис. 7B).

Кутикулярный воск в трансгенных и контрольных листьях под микроскопом

Сравнение депарафинированных листьев из контроля (рис. 8А), трансгенного G . hirsutum (рис. 8C и 8D) и G . arboreum (рис. 8В) показал четкую разницу в содержании парафина. Значительно улучшенное содержание парафина наблюдалось в листьях трансгенных растений по сравнению с контролем, тогда как G . arboreum показал самое высокое содержание парафина (рис. 8).Результаты четко описывают, что содержание парафина улучшилось в трансгенном хлопке, и его связь со склонностью к белокрылке и титр CLCuV продемонстрировали прямую связь между содержанием парафина и передачей CLCuV.

Рис. 8.

(A): Нетрансгенный (контроль) Gossypium hirustum после удаления воска. (B): Gossypium arboreum после удаления парафина (C): Transgenic Gossypium hirustum показывает более высокое удаление парафина после обработки органическим растворителем. (D): Трансгенный Gossypium hirustum демонстрирует более высокое удаление парафина после обработки органическим растворителем.

https://doi.org/10.1371/journal.pone.0250902.g008

Обсуждение

Кутикула поверхности растения действует как барьер или первая линия защиты от насекомых, приближающихся к поверхности растения. Слой растения, пропитанный внутрикутикулярным и эпикутикулярным восками, называется кутикулой [35]. Хотя роль эпикутикулярных восков против взаимодействия насекомых и растений уже была определена, взаимодействие восковых соединений с насекомыми, которые проявляют восприимчивость или устойчивость к насекомым, не исследовалось.

Болезнь скручивания листьев хлопчатника (CLCuD), вызываемая CLCuV, является серьезным заболеванием хлопчатника и некоторых других мальвовых растений, передаваемых белокрылкой Bemisia tabaci . Нет сообщений о том, что разновидность Gossypium hirsutum устойчива к разрушительному вирусу, носителем которого является белокрылка [9]. Об этой болезни сообщили в Пакистане и Индии, но постепенно она распространилась на другие хлопковые районы мира, особенно на юг Китая. Однако азиатский хлопок ( Gossypium aroboreum ) устойчив к этому заболеванию.Хотя точный механизм точно не определен, более высокие количества эпикутикулярных восков описаны как один из ключевых барьеров для белокрылки у Gossypium aroboreum [11, 31, 36]. Хан и др. В 2015 г. сообщалось, что разные виды хлопка имеют разное количество парафина и различия в их реакции с точки зрения устойчивости к вирусам и восприимчивости [31].

Принимая во внимание важность, была предпринята попытка определить различие соединений парафина в четырех разных типах генотипов хлопчатника, а затем ген биосинтеза парафина CER3 из Arabidopsis thaliana был трансформирован в Gossypium hirsutum , чтобы выяснить, увеличиваются ли эпикутикулярные Количество воска может снизить успешность кормления белокрылкой и, в конечном итоге, титр CLCuV (рис. 6).Воски из четырех различных видов хлопчатника были выделены методом отварки, как описано в [5]. Восковые соединения были выровнены с использованием PyMOL версии 2.3, как сообщается в [37], чтобы увидеть разницу (дополнительные данные), и соединения были дополнительно идентифицированы с помощью ГХ-МС (дополнительные данные), и было проведено сравнение восковых соединений всех четырех генотипов. Более восприимчивы к белокрылке, G . hirsutum показал присутствие пяти различных соединений, то есть трихлоруксусной кислоты, гексадецилэфира, п-ксиленолфталеина, 2-циклопентен-1-ол, 1-фенил- и фенола, 2,5-бис [1,1-диметил], которые показали связь с хитином белокрылки (рис. 1 и 2).На рис. 7A показано количество посещений белокрылкой разных видов хлопка в одних и тех же условиях, которое, по расчетам, является самым высоким для G . hirsutum . Хотя точный механизм взаимодействия и отталкивания насекомых еще не выяснен более подробно, полученные данные доказали, что повышенное содержание эпикутикулярных восков делает его менее привлекательным для насекомых [38, 39]. Трансгенные растения Gossypium hirsutum с улучшенными эпикутикулярными восками показали большую устойчивость к насекомым и оказались менее привлекательными для белокрылки по сравнению с его нетрансгенной версией (рис. 7B), что подтверждает идею о том, что улучшенное содержание воска делает его менее привлекательным для белокрылки. привлекателен для белокрылки.Чтобы сравнить содержание парафина в трансгенном и контрольном растении, парафины удаляли с поперечных срезов листьев с помощью органического растворителя ксилола, и у трансгенных растений наблюдали значительно улучшенное содержание парафина по сравнению с контролем (фиг. 8). Помимо того, что белокрылки были менее привлекательными, они также значительно снизили успешность кормления и способность передавать вирус. Количество воска и данные о составе восковых соединений подтверждают идею о том, что определенные соединения, которые делают белокрылку привлекательной, приближается к G . hirsutum и улучшенное содержание воска обеспечивают значительную устойчивость против белокрылки.

Мы изучили перекрестные помехи между эпикутикулами белокрылки и листа, сравнивая трансгенные линии с улучшенным содержанием воска с нетрансгенной версией Gossypium hirsutum. Результаты продемонстрировали значительно низкий титр вируса у Gossypium hirsutum с повышенным содержанием парафина по сравнению с контрольными линиями. Gossypium hirsutum чувствителен к белокрылке и CLCuV [40], но по нашим результатам мы можем продемонстрировать, что улучшенное содержание воска может сделать его устойчивым к белокрылке и CLCuV.

Заключение

Исследование показало, что не только количество, но и состав парафина имеют свою роль в определении природы растений как восприимчивых или устойчивых, а также в обеспечении привлекательности для насекомых или наименьшего интереса насекомых к посещению растения, которое косвенно влияют на инфекции, переносимые насекомыми на растения, как и в случае титра CLCuV.

Ссылки

  1. 1.
    Müller C (2008) 13 Взаимодействие растений и насекомых на поверхности кутикулы.Annu Plant Rev Biol Plant Cuticle 23: 398.
  2. 2.
    Eigenbrode SD, Pillai SK (1998) Ответ новорожденных Plutella xylostella на поверхностные парафиновые компоненты устойчивой капусты (Brassica oleracea). J Chem Ecol 24: 1611–1627.
  3. 3.
    Viladomat F, Bastida J (2015) Общий обзор вторичного метаболизма растений. Биология растений и биотехнология: 539–568.
  4. 4.
    Арагон В., Рейна-Пинто Дж. Дж., Серрано М. (2017) Интимный разговор между растениями и микроорганизмами на поверхности листьев.J Exp Bot 68: 5339–5350. pmid: 256
  5. 5.
    Handa S (2008) Обзор методов экстракции лекарственных и ароматических растений. Технологии экстракции лекарственных и ароматических растений 1.
  6. 6.
    Cavonius LR, Carlsson N-G, Undeland I (2014) Количественная оценка общего количества жирных кислот в микроводорослях: сравнение методов экстракции и переэтерификации. Anal Bioanal Chem. 406: 7313–7322. pmid: 25224639
  7. 7.
    Torres CA, Zamora CMP, Nuñez MB, Gonzalez AM (2018) Антиоксидантная, антилипоксигеназная и антимикробная активность экстрактов семи вьющихся растений, принадлежащих к Bignoniaceae, in vitro.J Integr Med 16 (4), 255–262. pmid: 29759936
  8. 8.
    Хан МАУ, Шахид А.А., Рао А.К., Шахид Н., Латиф А. и др. (2015) Стратегии защиты хлопка от CLCuV и бегомовирусов, передаваемых белокрылкой. Adv. наука о жизни. 2: 58–66.
  9. 9.
    Назир В., Типу А.Л., Ахмад С., Махмуд К., Махмуд А. и др. (2014) Оценка устойчивости к вирусу курчавости листьев хлопчатника в потомках BC 1, BC 2 и BC 3 от межвидового скрещивания Gossypium arboreum и Gossypium hirsutum. PloS one 9: e111861.pmid: 25372141
  10. 10.
    Маджид М.Ю., Шер З., Рашид Б., Али К., Сарвар МБ и др. (2020) Роль эпикутикулярной восковой нагрузки и состава листьев в отношении популяции белокрылки и вируса скручивания листьев хлопчатника у различных сортов хлопка. Цитология и генетика 54: 472–486.
  11. 11.
    Barozai MYK, Husnain T (2014) Развитие и характеристика мутантов эпикутикулярного воска листьев азиатского дези хлопка (Gossypium arboreum L.). Пак Дж. Бот 46: 639–643.
  12. 12.
    Wu Z, Yang Y, Huang G, Lin J, Xia Y и др.(2017) Функциональная геномика хлопка раскрывает глобальное понимание эволюции генома и развития волокон. Дж. Генет Геномика 44 (11), 511–518. pmid: 2

    21

  13. 13.
    Eigenbrode SD, Espelie KE (1995) Эффекты эпикутикулярных липидов растений на насекомых-травоядных. Анну Преподобный Энтомол 40: 171–194.
  14. 14.
    Горб Е.В., Горб С.Н. (2017) Антиадгезионные эффекты растительного воска на прикреплении насекомых. J Exp Bot 68: 5323–5337. pmid: 28992238
  15. 15.
    Hopkins RJ, van Dam NM, van Loon JJ (2009) Роль глюкозинолатов во взаимоотношениях насекомых и растений и мультитрофических взаимодействиях.Анну Преподобный Энтомол 54: 57–83. pmid: 18811249
  16. 16.
    Лам П., Чжао Л., Макфарлейн Х.Э., Айга М., Лам В. и др. (2012) RDR1 и SGS3, компоненты РНК-опосредованного сайленсинга генов, необходимы для регуляции биосинтеза кутикулярного воска в развивающихся стеблях соцветий Arabidopsis. Физиология растений 159: 1385–1395. pmid: 22689894
  17. 17.
    Ван Т, Син Дж., Лю Х, Яо Й, Ху Зи и др. (2018) GCN5 способствует биосинтезу кутикулярного воска ствола путем ацетилирования гистонов CER3 у Arabidopsis.Журнал экспериментальной ботаники 69: 2911–2922. pmid: 29506042
  18. 18.
    Weng H, Molina I, Shockey J (2010) Слияние органов и дефектная функция кутикулы у двойного мутанта lacs1lacs2 Arabidopsis. Планта 231: 1089–1100. pmid: 20237894
  19. 19.
    Бернар А., Домерг Ф., Паскаль С., Джеттер Р., Ренне С. и др. (2012) Восстановление биосинтеза растительных алканов в дрожжах демонстрирует, что Arabidopsis ECERIFERUM1 и ECERIFERUM3 являются основными компонентами комплекса синтеза алканов с очень длинной цепью.Растительная клетка 24: 3106–3118. pmid: 22773744
  20. 20.
    Zeisler-Diehl V, Müller Y, Schreiber L (2018) Эпикутикулярный воск на кутикуле листа не устанавливает транспирационный барьер, который в основном формируется внутрикутикулярным воском. J. Физиология растений 227: 66–74. pmid: 29653782
  21. 21.
    Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Клонирование и характеристика гена WAX2 Arabidopsis, участвующего в кутикулярной мембране и производстве воска. Растительная клетка 15: 1170–1185.pmid: 12724542
  22. 22.
    Фарук А., Фарук Дж., Махмуд А., Шакил А., Рехман К.А. и др. (2011) Обзор болезни, вызванной вирусом курчавости листьев хлопчатника (CLCuD), серьезной угрозой для урожайности хлопка. Aust J Crop Sci 5: 1823.
  23. 23.
    Zhang T, Hu Y, Jiang W, Fang L, Guan X и др. (2015) Секвенирование аллотетраплоидного хлопка (Gossypium hirsutum L. согласно TM-1) обеспечивает ресурс для улучшения волокна. Nat Biotechnol 33: 531–537. pmid: 25893781
  24. 24.
    Easlon HM, Bloom AJ (2014) Easy Leaf Area: автоматический анализ цифровых изображений для быстрого и точного измерения площади листа.Appl Plant Sci 2: 1400033. pmid: 25202639
  25. 25.
    Ахарони А., Диксит С., Джеттер Р., Тонес Э., ван Аркель Г. и др. (2004) Клада SHINE факторов транскрипции домена AP2 активирует биосинтез воска, изменяет свойства кутикулы и придает засухоустойчивость при сверхэкспрессии у Arabidopsis. Растительная клетка 16: 2463–2480. pmid: 15319479
  26. 26.
    Рехман И., Афтаб Б., Билал С.М., Рашид Б., Али К. и др. (2017) Экспрессия генов в ответ на инфекцию вируса курчавости листьев хлопчатника у Gossypium hirsutum в различных условиях окружающей среды.Генетика (0534–0012) 49
  27. 27.
    Георгиева В., Звездова Д., Влаев Л. (2012) Неизотермическая кинетика термического разложения хитозана. Chem Cent J 6: 1–10. pmid: 22214530
  28. 28.
    Пушито А.Н., Рао А.К., Хафиз М.Н., Икбал М.С., Баджва К.С. и др. (2015) Трансформация и оценка Cry1Ac + Cry2A и GTGene в Gossypium hirsutum L. Front Plant Sci 6: 943. pmid: 26617613
  29. 29.
    Чхалгри М.А., Хан М.Т., Низамани Г.С., Ясмин С., Хан И.А. и др. (2020) Влияние гормонов роста растений на регенерацию побегов и корней у роз в условиях in vitro.Adv. наука о жизни. 8: 93–97.
  30. 30.
    Кларк М.С. (2013) Молекулярная биология растений — лабораторное руководство: Springer Science & Business Media.
  31. 31.
    Хан МАУ, Шахид А.А., Рао А.К., Баджва К.С., Самиулла Т.Р. и др. (2015) Молекулярная и биохимическая характеристика эпикутикулярного воска хлопка в защите от болезни курчавости листьев хлопчатника. Иран Дж. Биотехнология 13: 3. Pmid: 28959303
  32. 32.
    Пиллай К., Пол В., Шарма С. П. (2009) Хитин и полимеры хитозана: химия, растворимость и образование волокон.Prog Polym Sci 34: 641–678.
  33. 33.
    Shi D, Lu Z, Dai G (1998) Синтез и кристаллическая структура диастереомерных рацематов 2-амино-3-циано-1-фенил-4- (3,4-метилендиоксифенил) -2-циклопентен-1-ола. Chem Res Chin Univ 19: 1426–1430.
  34. 34.
    Bhuiyan MNI, Begum J (2010) Исследования химических компонентов эфирного масла листьев и соцветий Hyptis brevipes (Poit.). J. Med Plant Res. 4: 2128–2131.
  35. 35.
    Серрано М., Колучча Ф, Торрес М., L’Haridon F, Métraux J-P (2014) Кутикула и защита растений от патогенов.Front Plant Sci 5: 274. pmid: 24982666
  36. 36.
    Муштак Р., Шахзад К., Мансур С., Шах З. Х., Алсамадани Х. и др. (2018) Изучение генов устойчивости к вирусу курчавости листьев хлопка и их скрининг в Gossypium arboreum путем нацеливания на аналоги генов устойчивости. AoB Plants 10: ply067. pmid: 30487965
  37. 37.
    Поморский Т.Г., Менон А.К. (2016) Липидные кульбиты: раскрытие механизмов опосредованного белками переворота липидов. Prog Lipid Res 64: 69–84. pmid: 27528189
  38. 38.Снидарчич Д., Валич Н., Трдан С. (2008) Эпикутикулярное содержание воска в листьях капусты (Brassica oleracea L. var. Capitata) как механический барьер против трех насекомых-вредителей. Acta Agric Slov 91: 361–370.
  39. 39.
    Левандовска М., Кейл А., Фойсснер И. (2020) Биосинтез воска в ответ на опасность: его регулирование при абиотическом и биотическом стрессе. Новый Фитол. 227: 698–713. pmid: 32242934
  40. 40.
    Накви Р.З., Заиди С.С.-е-А, Мухтар М.С., Амин И., Мишра Б. и др.(2019) Транскриптомный анализ культурного хлопка Gossypium hirsutum дает представление об ответах хозяина на опосредованную белокрылкой передачу болезни курчавости листьев хлопка. PloS one 14: e0210011. pmid: 30730891

Whitefly — обзор | ScienceDirect Topics

Aleyrodidae: шерстистая белокрылка (

Aleurothrixus floccosus (Maskell))

Происхождение шерстистой белокрылки неизвестно, но она широко распространена в Вест-Индии, Центральной и Южной Америке (Clausen, 1978).Вредитель в первую очередь цитрусовых. Платигастерид Amitus spiniferus (Brethes) и две афелиниды Eretmocerus paulistis Heimpel и Cales noacki De Santis успешно использовались в качестве агентов биологической борьбы в Чили, Мексике и Франции (Luck, 1981).

В Сан-Диего, Калифорния, цитрусовые выращивают как садовое и декоративное дерево. Шерстистая белокрылка была впервые обнаружена здесь в 1966 году (DeBach & Rose, 1976). ДеБах наблюдал, что белокрылка находится под хорошим контролем на материковой части Мексики и в A.spiniferus, E. paulistis, и Encarsia sp. были завезены в небольшом количестве в Сан-Диего в 1967 г. (DeBach & Rose, 1976). Первые два паразитоида хорошо прижились и показали себя многообещающими в качестве агентов биологической борьбы. В 1969 году Департамент продовольствия и сельского хозяйства Калифорнии решил искоренить белокрылку с помощью химических инсектицидов. Поэтому программа биологической борьбы была остановлена ​​в Сан-Диего и перенесена в Северную Нижнюю Калифорнию в Мексике, где белокрылка также была обнаружена вскоре после ее открытия в Сан-Диего (DeBach & Rose, 1976).Тридцать A. spiniferus и 169 E. paulistis были колонизированы в Тихуане в 1969 году. Два из первоначально колонизированных деревьев использовались в качестве питомников. За один год в результате переноса веточек с паразитирующей белокрылкой более 27 000 из двух паразитоидов были распределены по Тихуане (DeBach & Rose, 1976). Также был выпущен четвертый паразитоид, C. noacki, из Чили. К концу 1970 года эти три паразитоида были прочно обоснованы, и казалось, что программа биологической борьбы оказалась успешной.

В Сан-Диего программа биологической борьбы была возобновлена ​​в 1971 году, когда был свернут неудавшийся проект ликвидации (DeBach & Rose, 1976). Площадь, зараженная белокрылкой в ​​Калифорнии, составляла около 200 квадратных миль. Калифорнийский университет в Риверсайде и Калифорнийский департамент продовольствия и сельского хозяйства совместно выпустили паразитоидов, которые были собраны в Тихуане или импортированы из материковой Мексики, Чили и Бразилии. Паразитоиды были колонизированы на всех участках выпуска в Сан-Диего в 1971 году, и эти участки предоставили деревья-питомники для дальнейшего выпуска паразитоидов в 1972 году.Шерстистая белокрылка продолжала расти в Калифорнии, но к 1973 году программа биологической борьбы оказалась успешной в округе Сан-Диего и Тихуане (DeBach & Rose, 1976).

В 1973 году японский жук ( Popillia japonica Newman) был неожиданно обнаружен в Сан-Диего, и была создана зона уничтожения около 100 городских кварталов. Было проведено исследование для изучения воздействия на естественных врагов шерстистой белокрылки трех химических веществ (карбарил, хлордан и дикофол), которые должны были использоваться в программе искоренения жуков (DeBach & Rose, 1977).Дикофол использовался для борьбы с клещами из-за разрушения, вызванного обработкой искоренения. В этом исследовании было показано, что усилия по искоренению японского жука нарушили биологический контроль над шерстистой белокрылкой. До начала химической обработки два паразитоида белокрылки A. spiniferus и C. noacki были широко распространены, и другие вредители цитрусовых также находились под надежным биологическим контролем. После обработки популяция белокрылки резко увеличилась и была в 1200 раз выше на обработанных участках, чем на необработанных.Также увеличились популяции цитрусового красного клеща, Panonychus citri (McGregor) и пурпурного клеща, Cornuapis (= Lepidosaphes ), beckii (Newman) (DeBach & Rose, 1977). После завершения обработок A. spiniferus и C. noacki начали возвращаться на ранее обработанные участки.

Побочные эффекты программ ликвидации не были хорошо задокументированы. Отчасти это связано с тем, что большинство этих программ проводится в городских условиях.Проекты по искоренению посевов с использованием инсектицидов широкого спектра действия предоставляют уникальную возможность изучить биологический контроль в городской среде. Программа искоренения средиземноморской плодовой мухи Ceratitis capitata (Wiedemann) в 1980–1982 годах с использованием спрея для приманки из малатиона в северной Калифорнии привела к нарушению биологического контроля над различными насекомыми в городских районах (Dreistadt & Dahlsten, 1986). В садах на обработанных территориях было больше клещей, тлей и белокрылок, чем в садах на необработанных территориях (Troetschler, 1983).Снижение контроля над другими насекомыми в городских районах, такими как ореховая тля, Chromaphis juglandicola (Kaltenbach) и черная чешуя, Saissetia oleae (Bernard), также объясняется воздействием спрея на их естественных врагов (Ehler И Эндикотт, 1984). В другом исследовании паразитоиды ирисовой белокрылки, Aleyrodes spiraeoides Quaintance, были значительно более восприимчивы к брызгам малатиона приманки, чем белокрылки, и паразитизм был значительно ниже на растениях в обработанных областях (Hoelmer & Dahlsten, 1993).

Bemisia argentifolii — Bugwoodwiki

Таксономия

Королевство:

Animalia

Тип:

Arthropoda

Класс: 8a2

Отряд Hemiptera

Семейство:

Aleyrodidae

Род:

Bemisia

Виды:

B.argentifolii

Подвиды:

B. argentifolii

Научное наименование

Bemisia argentifolii
Bellowsony & Perring

07

5


Bellows & Perring
Bemisia tabaci Biotype B
(Gennadius, 1889)

Общие названия

silverleaf whitefly, sweetpotato whitefly, sweetpotato whitefly

Авторы: Dr.Рэнди Хадсон, доктор Дэвид Адамс, , Университет Джорджии, Отделение энтомологии.

Взрослая белокрылка серебристого листа мала, составляет около 0,9–1,2 мм в длину, и в состоянии покоя держит свои твердые белые крылья, похожие на крышу, над бледно-желтым телом. Ползун и нимфа совсем не похожи на взрослых. Нимфы представляют собой уплощенные, овальные чешуевидные образования. Яйца продолговатые, желтые, около 0,2 мм.

Ареал хозяев белокрылки серебристой листовой насчитывает более 500 видов растений.Среди них — сорняки и культурные овощи, агрономические и декоративные культуры.

И взрослые, и нимфальные белокрылки серебристого листа питаются нижней поверхностью листьев, высасывая сок своими колюще-сосущими ротовыми частями. Вокруг мест кормления на верхней поверхности листьев могут появиться хлоротичные пятна. Белокрылки производят медвяную росу, на которой может расти сажистая плесень; тем самым уменьшая проникновение света; следовательно, снижение урожайности и качества. На тыкве они вызывают состояние, известное как серебристый лист, при котором листва становится сильно отражающей, а плоды бледными.На томатах белокрылка чернолистная может вызывать состояние, известное как неравномерное созревание плодов, и передавать вирусные заболевания.

Первая стадия вылупления известна как краулер (0,2-0,3 мм), который перемещается в поисках подходящего места для прикрепления на нижней стороне листа. Став сидячим, происходит еще три линьки в виде сплющенной овальной нимфы. Для того, чтобы превратиться из яйца в взрослую особь при высоких температурах, требуется всего 18 дней.

Для многих культур отказ от применения инсектицидов — одна из лучших экономичных альтернатив.Однако бак с инсектицидами, смешанный с пиперонилбутоксидом или инсектицидным мылом, дает хороший контроль. Масляные спреи очень полезны для снижения риска появления серебристого листа на тыкве.

Отношения

Отношения

Пуансеттия и
Белокрылка

Как упоминалось ранее,
дитерпеновые эфиры (токсины) пуансеттии вызывают

это иметь немного естественных хищников.
Белокрылка — исключение.Многочисленные виды белокрылки, в том числе белокрылка тепличная ( Trialeurodes vaporariorum ),
белокрылка сладкого картофеля ( Bemisia tabaci ) и белокрылка серебристого листа
( Bemisia argentifolii )
действуют как паразиты для Euphorbia pulcherrima. Они могут сделать это несколькими способами.
После приземления на
растение, белокрылка обычно располагается на
нижняя сторона листьев пуансеттии.Там они либо
потреблять листья или проникать в сосудистую систему и поглощать сахар
и другие питательные вещества напрямую
из флоэмы. В любом случае причины
большой урон растению. А
самка белокрылки может и дальше паразитировать
пуансеттия, откладывая яйца (от 60 до 100 в зависимости от вида)
на нижней стороне
листья пуансеттии. Когда яйца вылупляются, нимфы продолжают кормиться
на листьях пуансеттии.

Пуансеттия и грибы

Пуансеттия известна
чтобы сформировать какие-то мутуалистические (выигрывают оба организма) отношения с грибами.Однако эти грибы не имеют грибовидной формы, которую мы обычно ассоциируем.
с грибком. Скорее, эти грибы, которые растут на и вокруг
корни пуансеттии известны
как микоризы. В то время как микориза получает пользу от порции
фотосинтетических
произведенный сахар, пуансеттия получает внешние питательные вещества, которые
грибок захватывает и возвращает обратно в клетки корня.
Микоризы, вступающие в такие отношения с другим растением, могут быть
видно справа.

Пуансеттия и птицы / насекомые


Пуансеттия и многие птицы
и насекомые вступают в мутуалистические отношения. Будучи цветением
растение, пуансеттия
цветы производят нектар и, будучи втянутыми красивыми красными прицветниками,
насекомые и птицы могут питаться
на этом нектаре. Сам того не зная, они также приносят пользу пуансеттии.
Во время кормления организм
обычно контактирует с тычинками цветка, производящими пыльцу, в течение которых
пыльца может быть захвачена организмом.Организм также будет контактировать
самка неоплодотворенная
женский цветок. Здесь пыльца может быть стерта, таким образом перекрестно удобряя
пуансеттия и помогая ей
размножаются с генетической изменчивостью.

Пуансеттия и люди

Пуансеттия и человек имеют различные разновидности
отношений, которые могут быть хорошими или плохими в зависимости от выбранной точки зрения. Из
отрицательный аспект, люди могут быть хищниками пуансеттии, иногда
вызывая их
гибели при удалении их из естественного
среда.Кроме того, пуансеттия может нанести вред человеку.
(и другие организмы, которые пытаются их съесть) с токсинами, которые они производят.
С другой стороны,
отношения также могут быть мутуалистическими. В то время как
человек наслаждается красотой растения, растение может со временем приспособиться к
более прохладной окружающей среде и естественным образом расти в
такие области, которые могут быть полезны для вида. Кроме того, люди и
пуансеттия зависят от побочных продуктов друг друга. Люди используют кислород, выделяемый пуансеттией
во время фотосинтеза для осуществления дыхания (также известного как
метаболизм).Растение приносит пользу
использование углекислого газа, выделяемого людьми в качестве побочного продукта
дыхание во время фотосинтеза
процесс.

>>> Интересные факты >>>

Веб-сайт
Создано Christine Vick

март / апрель
2009

Вопросы?
Комментарии? Напишите мне на [email protected]

Свидетельств быстрых пространственно-временных изменений генетической структуры чужеродной белокрылки во время первоначального вторжения

  • Timm, A.Э., Герцема Х. и Варнич Л. Популяционная генетическая структура Grapholita Molesta (Lepidoptera: Tortricidae) в Южной Африке. Анна. Энтомол. Soc. Амер. 101, 197–203 (2008).

    Артикул

    Google ученый

  • Чен, М. Х. и Дорн, С. Микросателлиты выявляют генетическую дифференциацию среди популяций у видов насекомых с высокой генетической изменчивостью в расселении, плодожорки, Cydia pomonella (L.) (Чешуекрылые: Tortricidae). Бык. Энтомол. Res. 100, 75–85 (2010).

    Артикул
    CAS
    PubMed

    Google ученый

  • Торриани, М. В. Г., Мацци, Д., Хайн, С., Дорн, С. Структурированные популяции восточной плодовой моли в сельскохозяйственной экосистеме. Мол. Ecol. 19, 2651–2660 (2010).

    Артикул
    CAS
    PubMed

    Google ученый

  • Кирк, Х., Дорн, С. и Мацци, Д. Молекулярная генетика и геномика позволяют по-новому взглянуть на вторжения беспозвоночных вредителей. Evol. Прил. 6. С. 842–856 (2013).

    Артикул
    CAS
    PubMed
    PubMed Central

    Google ученый

  • Sakai, A. K. et al. Популяционная биология инвазионных видов. Анна. Rev. Ecol. Syst. 32, 305–332 (2001).

    Артикул

    Google ученый

  • Локвуд, Дж.Л., Хупес, М. Ф. и Маркетти, М. П. Экология вторжения. Blackwell Press, Малден, Массачусетс (2007).

  • Де Барро, П. Дж. И др. Пространственная и временная генетическая изменчивость в британских полевых популяциях зерновой тли Sitobion avenae (F) (Hemiptera: Aphididae) изучалась с помощью RAPD-PCR. П. Рой. Soc. Б – Биол. Sci. 262, 321–327 (1995).

    Артикул
    ОБЪЯВЛЕНИЯ
    CAS

    Google ученый

  • Vorburger, C. Временная динамика генотипического разнообразия выявляет сильный клональный отбор у тли Myzus persicae .J. Evolution. Биол. 19, 97–107 (2006).

    Артикул
    CAS

    Google ученый

  • Münzbergová, Z. et al. Пространственные и временные изменения в характере расселения инвазивной сосны. Биол. Invasions 12, 2471–2486 (2010).

    Артикул

    Google ученый

  • Франклин М. Т., Ритланд К. Э. и Майерс Дж. Х. Пространственные и временные изменения генетической структуры тепличных и полевых популяций кочанной капусты, Trichoplusia ni .Мол. Ecol. 19, 1122–1133 (2010).

    Артикул
    PubMed

    Google ученый

  • Dinsdale, A. et al. Быстрый генетический оборот в популяциях насекомых-вредителей Bemisia tabaci Ближний Восток: Малая Азия 1 в сельскохозяйственном ландшафте. Бык. Энтомол. Res. 102, 539–549 (2012).

    Артикул
    CAS
    PubMed

    Google ученый

  • Scott, K. D. et al.Оценка миграции бабочек и структурирования популяций у Helicoverpa armigera (Lepidoptera: Noctuidae) (Lepidoptera: Noctuidae) в региональном масштабе: пример из Дарлинг-Даунс, Австралия. J. Econ. Энтомол. 98, 2210–2219 (2005).

    Артикул
    PubMed

    Google ученый

  • Scott, K. D. et al. Генный поток между популяциями хлопковой совки Helicoverpa armigera (Lepidoptera: Noctuidae) сильно различается в разные годы.Бык. Энтомол. Res. 95, 381–392 (2005).

    Артикул
    CAS
    PubMed

    Google ученый

  • Carrière, Y. et al. Крупномасштабная, пространственно-явная проверка стратегии убежища для замедления устойчивости к инсектицидам. Pro. Natl. Акад. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 109, 775–780 (2012).

    Артикул
    ОБЪЯВЛЕНИЯ

    Google ученый

  • Dinsdale, A. et al. Уточненный глобальный анализ митохондриальной цитохромоксидазы 1 Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae) для определения генетических границ на уровне видов.Анна. Энтомол. Soc. Являюсь. 2010. Т. 103. С. 196–208.

    Артикул

    Google ученый

  • Де Барро, П. Дж., Лю, С. С., Бойкин, Л. М. и Динсдейл, А. Б. Bemisia tabaci : заявление о статусе вида. Анна. Преподобный Энтомол. 56, 1–19 (2011).

    Артикул
    CAS

    Google ученый

  • Hu, J. et al. Обширное полевое обследование в сочетании с филогенетическим анализом показывает быстрое и широко распространенное вторжение двух чужеродных белокрылок в Китай.PLoS ONE 6, e16061 (2011).

    Артикул
    ОБЪЯВЛЕНИЯ
    CAS
    PubMed
    PubMed Central

    Google ученый

  • Chu, D. et al. Интродукция экзотического биотипа Q Bemisia tabaci (Gennadius) из Средиземноморья в Китай на декоративных культурах. Fla. Entomol. 89, 168–174 (2006).

    Артикул

    Google ученый

  • Teng, X., Wan, F.H. & Chu, D. Bemisia tabaci , биотип Q доминирует над другими биотипами по всему Китаю. Fla. Entomol. 93, 363–368 (2010).

    Артикул

    Google ученый

  • Pan, H.P. et al. Дальнейшее распространение и доминирование Bemisia tabaci биотипа Q на полевых культурах в Китае. J. Econ. Энтомол. 104, 978–985 (2011).

    Артикул
    PubMed

    Google ученый

  • Дики, А.M. et al. Популяционная генетика инвазивных криптических видов Bemisia tabaci (Hemiptera: Aleyrodidae) в США на основе микросателлитных маркеров. J. Econ. Энтомол. 106. С. 1355–1364 (2013).

    Артикул
    PubMed

    Google ученый

  • Gottlieb, Y. et al. Эффективность передачи вируса желтого скручивания листьев томата белокрылкой Bemisia tabaci коррелирует с присутствием определенного вида симбиотических бактерий.J. Virol. 84, 9310–9317 (2010).

    Артикул
    CAS
    PubMed
    PubMed Central

    Google ученый

  • Pan, H.P. et al. Дифференциальное воздействие вируса экзотического растения на два его близкородственных вектора. Sci. Отчет 3, 2230 (2013).

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • Chu, D. et al. Статус биотипа и распределение Bemisia tabaci (Hemiptera: Aleyrodidae) в провинции Шаньдун в Китае на основе маркеров митохондриальной ДНК.Env. Энтомол. 36, 1290–1295 (2007).

    Артикул
    CAS

    Google ученый

  • Chu, D. et al. Дальнейшее понимание странной роли бактериальных эндосимбионтов у белокрылки, Bemisia tabaci : Сравнение вторичных симбионтов из биотипов B и Q в Китае. Бык. Энтомол. Res. 101. С. 477–486 (2011).

    Артикул
    CAS
    PubMed

    Google ученый

  • Чу, Д.и другие. Исследование генетического разнообразия инвазивной белокрылки в Китае с использованием как митохондриальных, так и ядерных ДНК-маркеров. Бык. Энтомол. Res. 101, 467–475 (2011).

    Артикул
    CAS
    PubMed

    Google ученый

  • Ren, S. X. et al. Прогресс исследований в области мониторинга, прогноза и устойчивого управления вредителями белокрылки в Китае. Китайский J. Appl. Энтомол. 48, 7–15 (2011).

    Google ученый

  • Чу, Д.и другие. Применение тиаметокса может снизить генетическое разнообразие Bemisia tabaci (Gennadius) биотипа B. Acta Entomologica Sinica 51, 150–154 (2008).

    Google ученый

  • Tsagkarakou, A. et al. Биотипический статус и генетический полиморфизм белокрылки Bemisia tabaci (Hemiptera: Aleyrodidae) в Греции: митохондриальная ДНК и микросателлиты. Бык. Энтомол. Res. 97, 29–40 (2007).

    Артикул
    CAS
    PubMed

    Google ученый

  • Франк, П., Рейес, П. Ф. М., Оливарес, Дж. И Сауфанор, Б. Генетическая архитектура в популяциях рыбной бабочки: сравнение микросателлитных маркеров и маркеров устойчивости к инсектицидам. Мол. Ecol. 16. С. 3554–3564 (2007).

    Артикул
    CAS
    PubMed

    Google ученый

  • Гимлер А.Г. и др. Быстрое распространение бактериального симбионта среди инвазивной белокрылки обусловлено преимуществами фитнеса и предвзятостью самок. Science 332, 254–256 (2011).

    Артикул
    ОБЪЯВЛЕНИЯ
    CAS
    PubMed

    Google ученый

  • Лю, Б.M. et al. Множественные формы векторных манипуляций с помощью вируса, инфицирующего растения: Bemisia tabaci и вирус желтого скручивания листьев томата . J. Virol. 87. С. 4929–4937 (2013).

    Артикул
    CAS
    PubMed
    PubMed Central

    Google ученый

  • Ryan, W. et al. Глобальный синтез топографии с несколькими разрешениями. Геохим. Geophys. Геосист. 10, (Q03014) (2009).

    Артикул

    Google ученый

  • Фрелих, Д.R. et al. Филогеографический анализ комплекса видов Bemisia tabaci на основе маркеров митохондриальной ДНК. Мол. Ecol. 8, 1683–1691 (1999).

    Артикул
    CAS
    PubMed

    Google ученый

  • Чу, Д., Чжан, Ю. Дж. И Ван, Ф. Х. Тайное вторжение экзотического Bemisia tabaci биотипа Q широко распространено в провинции Шаньдун в Китае. Fla. Entomol. 93, 203–207 (2010).

    Артикул

    Google ученый

  • Чу, Д., Ван, Ф. Х., Чжан, Ю. Дж. И Браун, Дж. К. Изменение биотипического состава Bemisia tabaci в провинции Шаньдун в Китае с 2005 по 2008 гг. Env. Энтомол. 2010. Т. 39. С. 1028–1036.

    Артикул

    Google ученый

  • Хасдан В. и др. ДНК-маркеры для идентификации биотипов B и Q Bemisia tabaci (Hemiptera: Aleyrodidae) и изучения динамики популяции. Бык. Энтомол. Res. 95, 605–613 (2005).

    Артикул
    CAS
    PubMed

    Google ученый

  • Де Барро, П.J. Генетическая структура белокрылки Bemisia tabaci в Азиатско-Тихоокеанском регионе, выявленная с помощью микросателлитных маркеров. Мол. Ecol. 14. С. 3695–3718 (2005).

    Артикул
    CAS
    PubMed

    Google ученый

  • Delatte, H. et al. Микроспутники выявляют обширные географические, экологические и генетические контакты между инвазивными и коренными биотипами белокрылки в островной среде. Genet. Res. 87, 109–124 (2006).

    Артикул
    CAS
    PubMed

    Google ученый

  • Де Барро, П.J. et al. Выделение и характеристика микросателлитных локусов в Bemisia tabaci . Мол. Ecol. Примечания 3, 40–43 (2003).

    Артикул
    CAS

    Google ученый

  • Yeh, F. C. et al. POPGENE, удобная условно бесплатная программа для популяционного генетического анализа. Центр молекулярной биологии и биотехнологии, Университет Альберты, Эдмонтон, Канада (1997).

  • Raymond, M. & Rousset, F. GENEPOP (версия 1.2): программа популяционной генетики для точных тестов и экуменизма. J. Hered. 86, 248–249 (1995).

    Артикул

    Google ученый

  • Excoffier, L., Laval, G. & Schneider, S. Arlequin (версия 3.0): интегрированный пакет программного обеспечения для анализа данных популяционной генетики. Evol. Биоинформ. Online 1, 47–50 (2005).

    Артикул
    CAS

    Google ученый

  • Корандер, Дж., Сирен, Дж. И Арджас, Э. Байесовское пространственное моделирование генетической структуры популяции.

  • Добавить комментарий

    Ваш адрес email не будет опубликован.